Informations

Surmonter la dépression de consanguinité

Surmonter la dépression de consanguinité


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

En cas de dépression de consanguinité, un individu génétiquement non apparenté est accouplé avec l'animal pour introduire une variabilité génétique et éliminer l'homozygotie. Dans ce cas, il est possible d'effectuer des croisements ou des croisements. Y a-t-il une préférence pour l'une ou l'autre technique par rapport à l'autre ? Le croisement fait ici référence à l'accouplement entre deux individus de la même race, mais aucun ancêtre commun récent. Le croisement fait référence à l'accouplement entre deux individus de races différentes.


La dépression de consanguinité peut être surmontée par les moyens suivants : 1. L'élevage - l'élevage d'animaux qui ne sont pas liés les uns aux autres et qui n'ont pas d'ancêtres depuis 4 à 6 générations 2. Les croisements effectués avec les animaux de la même race mais après 4-6 générations 3. Croisement - mâle supérieur accouplé avec une femelle supérieure d'une autre race 4. Hybridations interspécifiques - animal mâle et femelle de deux espèces apparentées différentes


La base génétique de la dépression de consanguinité chez la pomme de terre

La dépression de consanguinité confère une aptitude réduite chez les descendants de parents génétiques. En tant que culture propagée par clonage, la pomme de terre (Solanum tuberosum L.) souffre d'une grave dépression de consanguinité, cependant, la base génétique de la dépression de consanguinité chez la pomme de terre est en grande partie inconnue. Pour mieux comprendre la dépression de consanguinité chez la pomme de terre, nous avons évalué le fardeau des mutations chez 151 pommes de terre diploïdes et obtenu 344 831 substitutions délétères prédites. Les mutations délétères chez la pomme de terre sont enrichies dans les régions péricentromériques et sont spécifiques à la lignée. En utilisant trois F2 populations, nous avons identifié 15 régions génomiques présentant de graves distorsions de ségrégation dues à la sélection aux stades gamétique et zygotique. La plupart des allèles récessifs délétères affectant la survie et la vigueur de croissance étaient localisés dans des régions avec des taux de recombinaison élevés. L'un de ces allèles délétères est dérivé d'une mutation rare qui perturbe un gène nécessaire au développement de l'embryon. Cette étude fournit la base pour la conception du génome des lignées consanguines de pomme de terre.


Surmonter la dépression de consanguinité - Biologie

Dans une petite population, les accouplements entre parents sont fréquents. Cette consanguinité peut réduire la capacité de la population à survivre et à se reproduire, un phénomène appelé dépression de consanguinité. Par exemple, une population de 40 additionneurs (Vipera berus, illustré à droite) ont connu une dépression de consanguinité lorsque les activités agricoles en Suède les ont isolés des autres populations de vipères. Des proportions plus élevées de descendants mort-nés et déformés sont nés dans la population isolée que dans les populations plus importantes. Lorsque les chercheurs ont introduit des vipères d'autres populations (un exemple de croisement exogame), la population isolée s'est rétablie et a produit une proportion plus élevée de descendants viables.

L'explication de la dépression de consanguinité réside dans l'histoire évolutive de la population. Au fil du temps, la sélection naturelle élimine les allèles délétères d'une population - lorsque les allèles délétères dominants sont exprimés, ils réduisent la forme physique du porteur et moins de copies se retrouvent dans la génération suivante. Mais les allèles délétères récessifs sont « cachés » de la sélection naturelle par leurs homologues dominants non délétères. Un individu porteur d'un seul allèle délétère récessif sera en bonne santé et pourra facilement transmettre l'allèle délétère à la génération suivante.

Lorsque la population est importante, ce n'est généralement pas un problème — la population peut porter de nombreux allèles délétères récessifs, mais ils sont rarement exprimés. Cependant, lorsque la population devient petite, les parents proches finissent par s'accoupler, et ces parents portent probablement le même allèles délétères récessifs. Lorsque les parents s'accouplent, la progéniture peut hériter deux copies du même allèle délétère récessif et subissent les conséquences de l'expression de l'allèle délétère, comme le montre l'exemple ci-dessous. Dans le cas des vipères suédois, cela signifiait une progéniture mort-née et des malformations.

Pour les vipères suédois, la solution au problème de la dépression de consanguinité était simple : introduire des vipères d'autres populations. Mais si le wombat à nez poilu du Nord souffre de dépression de consanguinité, aucune autre population ne peut le sauver. Comprendre l'histoire évolutive d'une population et la probabilité qu'elle porte des allèles délétères récessifs, suggère que nous ne devrions pas laisser la taille des populations baisser trop bas dans nos efforts de conservation, ou la dépression de consanguinité peut mettre en péril la survie de l'espèce.


Aspects négatifs de la pratique d'élevage

Nihar Ranjan Chattopadhyay , dans Élevage induit de poissons , 2017

5.3.12 Extinction locale en présence de migration

La dépression de consanguinité est normalement réduite par les immigrants qui sont hétérozygotes pour les mutations récessives délétères (Whitlock et al., 2000), et par hétérosis, la valeur adaptative moyenne des populations peut être améliorée. Cependant, le croisement peut réduire la valeur adaptative moyenne de la population si l'hybridation perturbe les complexes de gènes coadaptés ou les interactions épistatiques favorables (dépression de croisement). Peu d'études ont démontré la dépression de consanguinité car elle nécessite un suivi au-delà F1 génération. Une étude sur les bruants chanteurs ( Marr et al., 2002 ) a montré des signes de dépression de consanguinité dans le F2 génération, et les mesures de fitness étaient faibles dans la F2 génération de croisements du copépode marécageux (Tigriopus californium) de différentes populations ( Burton, 1990 ). Cependant, cet effet de rupture des coadaptations n'est amplifié que si la distance génétique entre les deux populations s'est fortement accrue ( Edmands, 1999 ). Ainsi, la menace de la consanguinité pourrait ne pas être très grave dans la plupart des populations sauvages car il faut plusieurs générations dans des environnements contrastés pour que la distance génétique soit significativement grande.

La réduction ou l'augmentation de la condition physique dans une population après avoir reçu des immigrants dépend également des interactions entre plusieurs facteurs génétiques et non génétiques (degré d'épistasie, démographie, comportement, environnement, etc. Tallmon et al., 2004 ). Il pourrait donc être difficile de prédire si un événement d'immigration donné affectera le sauvetage génétique, en particulier lorsque les gestionnaires de la conservation ne comprennent pas les interactions entre les facteurs génétiques et non génétiques. Cependant, Gaggiotti (2003) a passé en revue des études sur des plantes telles que Lotus scopaire, Ipomopsis aggregata, et Silène diclinis et a conclu que la dépression de consanguinité peut être courante dans la nature, mais les avantages potentiels de la consanguinité l'emportent généralement sur les menaces de la dépression de consanguinité.


Goulots d'étranglement

Toutes les recommandations qui ont été faites dans la section précédente étaient basées sur le maintien d'un minimum constant de Ne's. Malheureusement, il est difficile de maintenir un N constante génération après génération. Quiconque a déjà géré une population de poissons sait très bien qu'il est difficile de maintenir une population stable. De nombreux facteurs concourent à réduire occasionnellement la taille de la population. Les diminutions drastiques et soudaines de la taille de la population sont appelées « goulets d'étranglement ». Les effets génétiques des goulots d'étranglement peuvent être dévastateurs et avoir des répercussions à long terme.

Comme cela a été décrit au chapitre 4, la moyenne Ne sur une série de générations est la moyenne harmonique, et non la moyenne arithmétique simple. Par conséquent, la génération avec le plus petit Ne a une influence disproportionnée sur la valeur moyenne. Cela signifie qu'un goulot d'étranglement peut considérablement réduire le N moyene, qui à son tour augmentera considérablement la consanguinité et la dérive génétique.

Par exemple, si un agriculteur veut maintenir un N constante de 100 pendant 10 générations mais connaît un goulot d'étranglement de 20 dans la génération 6, la moyenne Ne qu'il a produit est :

Nje veux dire peut être déterminé en utilisant le bouton &ldquo1/x&rdquo sur une calculatrice portative.

La moyenne arithmétique de cette série de Ne's est 92, donc moyen Ne est 22% plus petit que prévu. S'il y avait deux goulots d'étranglement de 20, moyenne Ne aurait chuté à seulement 55,6.

Les goulots d'étranglement peuvent avoir des effets graves et durables sur la consanguinité, car une fois que la consanguinité se produit, elle réduit le N future's, comme cela a été décrit au chapitre 4. L'impact des goulots d'étranglement sur la consanguinité moyenne dépend de la taille des goulots d'étranglement et de leur nombre. Une population mal gérée et qui connaît de multiples goulots d'étranglement où la population est réduite à relativement peu de mâles et/ou de femelles sera assez consanguine. En revanche, une population bien gérée qui connaît un seul goulot d'étranglement sera beaucoup moins affectée. Un seul goulot d'étranglement produira une augmentation immédiate de la consanguinité et la consanguinité moyenne peut augmenter pendant une génération ou deux (le montant dépend de la taille du goulot d'étranglement), mais si la population est correctement gérée pour minimiser la consanguinité avant et après le goulot d'étranglement, le la consanguinité moyenne plafonnera quelques générations après le goulot d'étranglement, et les dommages dus à la consanguinité pourraient ne pas être graves.

Figure 32. Effets des goulots d'étranglement sur la fréquence des gènes. Étant donné que la dérive génétique et la probabilité de perdre des allèles sont inversement proportionnelles au nombre effectif de reproduction (Ne), la taille d'un goulot d'étranglement détermine la quantité de changement génétique. Les fréquences de la UNE et une les allèles dans la population sont tous deux de 0,5. Comme le goulot d'étranglement (Ne) devient plus petite, la dérive génétique modifie la fréquence des gènes jusqu'à ce qu'à un extrême, la fréquence d'un allèle passe à zéro.

Les effets que les goulots d'étranglement peuvent avoir sur la dérive génétique sont bien plus dévastateurs. La probabilité de perdre un allèle est inversement proportionnelle à Ne, donc les chances de perdre l'allèle augmentent à mesure que Ne diminue. Les goulots d'étranglement augmentent considérablement la probabilité. L'effet qu'un goulot d'étranglement peut avoir sur la fréquence des gènes est illustré à la figure 32.

Par exemple, si un agriculteur essaie de maintenir un N constante de 344 pour 10 générations afin de produire une garantie de 99% pour garder un allèle dont la fréquence est de 0,01 (tableau 5) et il y a un goulot d'étranglement de 25 à la génération 8, la probabilité de perdre l'allèle lorsque la 10ème génération est produite est déterminé comme suit :

Étape 1. La probabilité de perdre l'allèle à chaque génération doit être déterminée.

Étape 2. La garantie de conserver l'allèle à chaque génération doit être déterminée (1,0 - probabilité de perdre l'allèle).

Les probabilités de perdre l'allèle et les garanties de conserver l'allèle pour les 10 générations sont :

NeÉtape 1 : Probabilité de perdre l'allèleÉtape 2 : Garantie de garder l'allèle
(P = (1,0 - q) 2Ne )(1.0 - P)
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
25 P = (0,99) 2 (25) = 0.6050060670.394993932
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852

Étape 3. La garantie de conserver l'allèle pendant 10 générations doit être déterminée. C'est le produit de la garantie de conserver l'allèle pour chaque génération, c'est-à-dire que les garanties pour chaque génération sont multipliées pour déterminer la garantie après la production de la 10e génération :

Garantie après 10 générations=(0.999006852)(0.999006852)(0.999006852)(0.999006852)
(0.999006852)(0.999006852)(0.999006852)(0.394993932)
(0.999006852)(0.999006852)
Garantie après 10 générations=0.3915

Étape 4. La probabilité de perdre l'allèle après 10 générations doit être déterminée. C'est 1.0 - la garantie de garder l'allèle :

Probabilité de perdre l'allèle = 1,0 - Garantie de garder l'allèle

Probabilité de perdre l'allèle = 1,0 - 0,3915

Probabilité de perdre l'allèle = 0,6085

Le goulot d'étranglement de 25 à la génération 8 a augmenté la probabilité de perdre l'allèle à la 10e génération de 0,01 (ce qui était l'objectif) à 0,6085.

L'effet global d'un seul goulot d'étranglement sur la dérive génétique est bien plus grave que celui de la consanguinité moyenne, et son apparition peut empêcher un éleveur ou un responsable de couvoir d'atteindre ses objectifs, même s'il a fait un travail remarquable pendant de nombreuses générations. En effet, une fois qu'un allèle est perdu, il ne peut être récupéré que par mutation ou par l'introduction d'un nouveau stock de géniteurs. Par conséquent, la prévention des goulots d'étranglement devrait être le principal objectif de gestion des stocks de géniteurs si l'objectif génétique est de minimiser les effets néfastes de la consanguinité et de la dérive génétique.


Quand la faune en voie de disparition devient consanguine

Les populations menacées de gorilles des plaines de l'Est sont maintenant si petites que l'espèce est confrontée à une nouvelle menace : la perte de diversité génétique.

Les gorilles ne peuvent pas faire de pause. En proie à la perte d'habitat, au braconnage, à l'instabilité politique et à d'autres menaces, les populations ont chuté. Désormais isolés en petites populations, certains gorilles de plaine de l'Est sont confrontés à une nouvelle menace : la perte de diversité génétique. À mesure qu'une population diminue, le pool génétique diminue souvent également. Si la baisse est suffisamment importante, la consanguinité peut même menacer la survie de l'espèce.

Le déclin de la capacité d'une population à survivre par la consanguinité est appelé dépression de consanguinité. Mais comme discuté par les biologistes Philip Hedrick et Steven Kalinowski dans Examens annuels, la dépression de consanguinité prend différentes formes selon les circonstances. Son impact sur la survie n'est pas facilement généralisable. Pour une espèce à longue durée de vie comme les gorilles, les impacts globaux de la consanguinité peuvent prendre des décennies à se manifester et sont difficiles à étudier.

La consanguinité est souvent étudiée en laboratoire à l'aide d'organismes comme la drosophile (mouches des fruits), où une petite population peut être élevée et examinée sur plusieurs générations. Dans de telles études, à mesure que la consanguinité augmente, les mutations nocives se concentrent généralement de plus en plus dans la population grâce à un processus appelé démasquage, mettant en danger la forme physique globale de la population. Au fur et à mesure qu'une population devient de plus en plus petite et consanguine, les conditions génétiques nuisibles deviennent plus courantes.

Bien entendu, les gènes ne fonctionnent pas isolément. L'interaction entre les gènes et l'environnement est cruciale. Dans certains cas, cela pourrait faire de la dépression de consanguinité un point discutable pour les espèces en voie de disparition, car des menaces externes telles que la perte d'habitat peuvent menacer l'extinction avant que la dépression de consanguinité ne fasse trop de victimes. Malheureusement, les espèces hautement menacées vivent généralement dans des environnements stressants. En d'autres termes, leur situation réelle peut être pire que ce que prédisent les modèles, et les populations consanguines font face à une probabilité de survie encore plus faible que les populations saines.

De plus, une petite population d'une espèce à l'état sauvage n'est pas la même chose qu'une population artificiellement petite dans un laboratoire. Une population de drosophiles de laboratoire, par exemple, est un échantillon de toute la vaste diversité génétique de drosophiles disponible. Pour une petite population en voie de disparition, la diversité génétique globale est faible et quelle que soit la diversité génétique présente dans la population réduite, c'est tout ce qu'il y a, une situation appelée goulot d'étranglement. Parfois, cela rend les mutations dangereuses courantes et cela peut directement menacer l'extinction.

Recevez notre newsletter

Chaque gène a différentes variantes, appelées allèles, qui surviennent par mutation. Un allèle d'un gène peut conférer un avantage, mais un allèle différent de ce même gène peut être nocif. Dans un goulot d'étranglement, la plupart des divers allèles, y compris les plus nocifs, sont rares. Parfois, un allèle mortel est démasqué et se manifeste chez un individu, tuant cet individu ou empêchant la reproduction. Étant donné que l'allèle nocif est rare au départ, ce résultat supprime ces allèles nocifs de la population. Dans de tels cas, la consanguinité accélère la perte d'allèles dangereux, ce qui peut au moins temporairement être bénéfique. D'autre part, les allèles nocifs mais non dévastateurs se fixent facilement dans de petites populations, réduisant insidieusement la valeur adaptative au fil du temps.

La bonne nouvelle est que parfois la consanguinité peut être atténuée ou même inversée par une introduction prudente de gènes. Cela pourrait signifier la réintroduction d'individus élevés en captivité ou un transfert sélectif entre des groupes isolés. De telles actions elles-mêmes comportent des risques, mais si la consanguinité est suffisamment grave, une action drastique peut être nécessaire.


Résultats

Génotypage et imputation

Tous les individus de l'étude ont été génotypés sur la puce Illumina Ovine SNP50 BeadChip titrant 51 135 SNP. De plus, 189 individus ont été génotypés sur la puce Ovine Infinium High-Density contenant 606 066 SNP. Pour augmenter la résolution génomique de nos analyses, nous avons combiné les génotypes autosomiques des deux puces SNP avec des informations de pedigree pour imputer les SNP manquants chez les individus génotypés à une densité de marqueurs inférieure à l'aide d'AlphaImpute 56. La validation croisée a montré que l'imputation était réussie, avec une médiane de 99,3 % de génotypes correctement imputés par individu (tableau supplémentaire 1). De plus, les coefficients de consanguinité inférés FROH étaient très similaires lors de la comparaison des individus génotypés sur la puce à haute densité (médiane FROH = 0,239) et les individus avec des SNP imputés (médiane FROH = 0,241), ce qui n'indique aucun biais évident dans l'abondance de la ROH inférée sur la base des données imputées (Fig. 1 supplémentaire). Après contrôle qualité, l'ensemble de données génomiques contenait 417 373 SNP polymorphes et autosomiques avec une fréquence moyenne des allèles mineurs (MAF) de 23 % (Fig. 2) et un taux d'appel moyen de 99,5 % entre les individus.

Modèles de consanguinité dans le génome

Nous avons d'abord exploré comment la consanguinité et la petite taille de la population à long terme (estimée Ne = 194 57)-formes en forme de ROH chez les moutons Soay (Fig. 1). Les individus avaient une moyenne de 194 ROH (sd = 11,6) de plus de 1,2 Mb, ce qui représentait en moyenne 24 % du génome autosomique (c'est-à-dire FROH = 0,24, plage = 0,18 à 0,50, figure supplémentaire 3). Le coefficient moyen de consanguinité individuelle FROH de moutons nés au cours d'une année donnée est resté constant au cours de la période d'étude (Fig. supplémentaire 4). Parmi les variations individuelles, la longueur de ROH était élevée : la ROH moyenne chez les sept moutons les plus consanguins était plus de deux fois plus longue que la ROH chez les sept moutons les moins consanguins (6,83 contre 2,72 Mb, respectivement Fig. 1a) bien que le nombre moyen de ROH était similaire (170 contre 169, respectivement).

une ROH supérieur à 5 Mb chez les sept individus ayant les coefficients de consanguinité les plus élevés FROH dans les sept rangées du haut et les sept individus avec le plus bas FROH dans les sept rangées du bas. b Répartition du ROH entre les différentes classes de longueur. Chaque point de données représente la proportion de ROH d'une certaine classe de longueur dans le génome autosomique d'un individu. Les classes de longueur ROH ont été classées en fonction de leur longueur physique moyenne attendue lorsque les haplotypes sous-jacents avaient un ancêtre commun le plus récent (MRCA) de 2 à 32 générations (g) depuis. c Densité de ROH à l'échelle du génome parmi les 5952 individus dans des fenêtres de 500 Ko sans chevauchement. Le dégradé de couleur a été mis à l'échelle en fonction de la densité ROH, qui est indiquée dans la légende de la figure.

L'abondance de ROH chez les moutons Soay variait également considérablement selon les classes de longueur de ROH (Fig. 1b). La plus grande fraction des MII dans la population était constituée de ROH entre 2,4 et 4,9 Mb provenant d'il y a environ 8 à 16 générations, qui représentaient en moyenne 8,1% du génome d'un individu. Des ROH longs > 19,5 Mb ont été trouvés chez 38,2 % des individus (Fig. 1b). Cependant, les ROH longs ne représentaient en moyenne que 0,6% du génome des individus les moins consanguins avec la consanguinité généalogique Fpéd < 0.1. En revanche, le long ROH s'étendait sur 7 % et 18 % du génome chez les individus consanguins avec Fpéd > 0,1 et Fpéd > 0,2, respectivement (Fig. 5 supplémentaire).

La fréquence de ROH dans la population variait considérablement à travers le génome (Fig. 1c). Nous avons scanné ROH dans des fenêtres de 500 Ko sans chevauchement et classé les fenêtres à 0,5 % avec la densité de ROH la plus élevée comme des îles ROH et les fenêtres à 0,5 % avec la densité de ROH la plus faible comme des déserts de ROH 31 . L'île ROH supérieure sur le chromosome 1 (227-227,5 Mb) contenait ROH dans 87% des individus, tandis que seulement 4,4% des individus avaient un ROH dans le désert ROH supérieur sur le chromosome 11 (58,5-59 Mb, voir le tableau supplémentaire 2 pour un liste des meilleurs déserts et îles de la ROH).

Densité ROH et taux de recombinaison

La grande variation de la densité de ROH le long du génome pourrait s'expliquer en partie par la recombinaison, car les régions avec un taux de recombinaison élevé produisent des ROH plus courts, et ceux-ci sont moins susceptibles d'être détectés par les algorithmes d'appel de ROH 30 . Notamment, la recombinaison en elle-même n'a pas d'impact sur la vraie proportion sous-jacente d'IBD, mais n'affecte que la distribution de la longueur de ROH. Par conséquent, les régions à forte recombinaison pourraient créer des déserts de ROH putatifs sans changement des niveaux réels de MII, car les ROH courts sont moins susceptibles d'être appelés 30 . Pour évaluer dans quelle mesure la variation de la densité de ROH le long du génome est due à la variation du taux de recombinaison et dans quelle mesure elle suit les niveaux sous-jacents de MII, nous avons construit un modèle mixte linéaire avec une densité de ROH (proportion d'individus avec ROH) mesurée en 500 Ko fenêtres comme variable de réponse, taux de recombinaison de fenêtre en cM/Mb basé sur la carte de liaison 58 de mouton de Soay et hétérozygotie SNP fenêtre comme effets fixes ainsi qu'un identifiant de chromosome comme effet aléatoire.

Le taux de recombinaison et l'hétérozygotie expliquent ensemble 42 % de la variation de la densité de ROH (marginal R 2 = 0,42, IC à 95 % [0,40, 0,44], Tableau supplémentaire 3A), avec la majorité de la variation expliquée par l'hétérozygotie (semi-partielle R 2 = 0,38, IC 95% [0,36, 0,40], Fig. 2b) et seulement environ 4% expliqué par le taux de recombinaison (semi-partielle R 2 = 0,04, IC à 95 % [0,02, 0,07], figure 2a et figure supplémentaire 6 pour un tracé chromosomique). Le schéma est similaire lors de la réexécution du modèle uniquement sur des fenêtres identifiées comme des îles et des déserts ROH, où la densité de ROH est largement expliquée par l'hétérozygotie (semi-partielle R 2 = 0,89, IC à 95 % [0,83, 0,94], Fig. 2d), avec seulement une faible proportion de la variation expliquée par la variation du taux de recombinaison (semi-partielle R 2 = 0,07, IC à 95 % [0,01, 0,12], figure 2c). Par conséquent, bien que le taux de recombinaison ait un impact sur les longueurs de ROH et donc sur les probabilités de détection de ROH, cela ne représente qu'une faible proportion de la variation de la densité de ROH détectée, qui reflète principalement les modèles sous-jacents de l'IBD le long du génome.

Les séries de densité d'homozygotie (ROH), de taux de recombinaison et d'hétérozygotie ont été quantifiées dans des fenêtres de 500 Ko sans chevauchement, chaque point représentant une fenêtre. Les 0,5 % supérieurs de fenêtres ayant la densité de ROH la plus élevée et la plus faible dans la population, appelés îlots ROH (m = 24) et les desserts (m = 24), sont colorées en violet et jaune respectivement dans les quatre parcelles. une Relation entre la densité de ROH et le taux de recombinaison. b Relation entre la densité ROH et l'hétérozygotie SNP. c Taux de recombinaison au sein des îles et déserts de la ROH. Hétérozygotie dans les îles et les déserts de la ROH. Les lignes pleines dans a et b sont des lignes de régression linéaire et des lignes pointillées dans c et sont des moyens à l'échelle du génome. Les boîtes à moustaches montrent la médiane sous la forme d'une ligne centrale avec les limites de la boîte aux 25e et 75e centiles et les moustaches supérieures et inférieures comme valeur la plus grande et la plus petite, mais pas plus de 1,5 * intervalle interquartile de la charnière. Les données sources de cette figure sont également fournies sous forme de fichier de données source.

Enfin, nous avons exploré dans quelle mesure la variation de la densité de ROH était expliquée par la recombinaison lors de l'utilisation de différents seuils de ROH minimum. Nous avons répété l'analyse avec un ensemble de données basé sur un seuil de longueur ROH minimum de 0,4 Mb, et un deuxième ensemble de données avec une longueur ROH minimum de 3 Mb (Tableau supplémentaire 3B, C). Par rapport à l'ensemble de données d'origine avec une longueur de ROH minimale de 1,2 Mo, la recombinaison a expliqué moins de variation de la densité de ROH dans l'ensemble de données, y compris une ROH plus courte (semi-partielle R 2 = 0,01, IC à 95 % [0,00, 0,04]) et plus de variation dans l'ensemble de données composé uniquement d'une ROH plus longue (semi-partielle R 2 = 0,08, IC à 95 % [0,06, 0,11]). Par conséquent, la variation du taux de recombinaison a un impact plus important sur l'abondance détectée de ROH plus long à travers le génome.

Dépression de consanguinité en survie

La survie est un élément clé de la condition physique. Chez les moutons Soay, plus de la moitié de tous les individus meurent au cours de leur premier hiver, minimisant leurs chances de se reproduire (Fig. 7). La survie des moutons est évaluée par des contrôles de mortalité de routine qui sont effectués tout au long de l'année. Plus de 80 % des moutons de la zone d'étude sont retrouvés après leur mort 50 , ce qui donne un total de 15 889 observations de survie annuelle pour 5 952 moutons. La distribution des coefficients de consanguinité individuels FROH dans différentes classes d'âge a révélé que les individus hautement consanguins survivent rarement à leurs premières années de vie et n'atteignent jamais un âge avancé (Fig. 3a). Cependant, la force de la dépression de consanguinité semble diminuer à des âges plus avancés (Fig. 3b). Par exemple, chez les moutons de plus de quatre ans, la proportion de survivants parmi les individus les plus consanguins n'était que légèrement inférieure à celle des individus les moins consanguins (Fig. 3b).

une Distributions des coefficients de consanguinité FROH dans les classes d'âge des moutons de Soay allant de 0 à 9 ans. b Proportion d'individus survivants par an à quatre stades de vie différents et parmi FROH Des classes. Comme les individus hautement consanguins sont relativement rares, la dernière classe couvre une gamme plus large de coefficients de consanguinité. Les données sources de cette figure sont également fournies sous forme de fichier de données source. c Probabilité de survie prédite et intervalles de crédibilité à 95 % sur la plage des coefficients de consanguinité FROH pour chaque étape de la vie tout en maintenant le sexe et le jumeau constants à 1 (mâle) et 0 (pas de jumeau). Les prédictions pour les classes de stades de vie plus avancés dépassent la plage des données, mais sont présentées sur toute la plage à des fins de comparabilité.

Nous avons modélisé la force de la dépression de consanguinité tout au long de la vie en utilisant un modèle animal avec une distribution d'erreur binomiale et la survie annuelle comme variable de réponse. Globalement, l'effet de la consanguinité sur la survie a été fort : chez les agneaux (âge 0), une augmentation de 10 % FROH était associée à un changement multiplicatif de 0,4 dans les chances de survie (rapport de cotes, OR [intervalle de crédibilité à 95 %, IC] = 0,40 [0,30, 0,53], tableau supplémentaire 4), ou à une réduction de 60 % (1–0,40) de la chances de survie. Cela se traduit par des différences de survie non linéaires sur l'échelle de probabilité. Par exemple, un agneau brebis Soay non-jumeau mâle avec un FROH 10 % au-dessus de la moyenne avait une probabilité inférieure de 23 % de survivre à son premier hiver par rapport à un agneau moyen (FROH = 0,34 contre FROH = 0,24 figure 3c). Tout au long de la durée de vie, le modèle estime les interactions entre FROH et les différents stades de la vie prédisaient une diminution de la force de la dépression de consanguinité dans les stades ultérieurs de la vie (Fig. 3c) avec la plus grande différence prédite entre le début (âge 1, 2) et la fin de la vie (âge 5+, OR [IC à 95 % ] = 2,03 [1,08, 3,82], tableau supplémentaire 4).

Nous avons ensuite estimé la charge de consanguinité chez les moutons Soay comme le nombre diploïde d'équivalents létaux 2B. Les équivalents létaux sont un concept ancré dans la génétique des populations, où un équivalent létal est égal à un groupe de mutations qui, si dispersées entre les individus, causeraient un décès en moyenne 59 . Nous avons suivi les suggestions de Nietlisbach et al. 60 et réajusté le modèle de survie avec une distribution de Poisson et une fonction de lien logarithmique en utilisant une structure de modèle simplifiée sans interactions pour une meilleure comparabilité entre les études. Cela a donné une estimation de 2B = 4,57 (IC à 95 % 2,61–6,55) équivalents létaux pour la survie annuelle des moutons Soay.

Architecture génétique de la dépression de consanguinité

Pour quantifier les conséquences de survie d'être IBD à chaque emplacement SNP, nous avons utilisé une étude d'association à l'échelle du génome modifiée (GWAS). Contrairement au GWAS traditionnel où p-les valeurs des effets SNP additifs sont intéressantes, nous avons analysé les effets du statut ROH pour les deux allèles à chaque SNP. Plus précisément, à un locus diallélique, ROH résulte soit de deux haplotypes IBD contenant l'allèle A, soit de deux haplotypes IBD contenant l'allèle B. Si des allèles récessifs fortement délétères existent dans la population, ils pourraient être associés à ROH basé sur les haplotypes de l'allèle A ou à ROH basé sur les haplotypes de l'allèle B. Pour tester cela, nous avons construit un modèle mixte binomial de survie annuelle pour chaque position SNP. Dans chaque modèle, nous avons ajusté deux prédicteurs de statut ROH. Le premier prédicteur a reçu un 1 si l'allèle A était homozygote et faisait partie d'un ROH et un 0 sinon. Le deuxième prédicteur a reçu un 1 si l'allèle B était homozygote et faisait partie d'un ROH et un 0 sinon. Estimations du modèle et pLes valeurs de ces deux prédicteurs reflètent donc si les ROH sont associés à des conséquences sur la survie à chaque emplacement SNP et pour chaque allèle. Dans le modèle GWAS, nous avons également contrôlé l'effet SNP additif et la consanguinité individuelle moyenne FROH (basé sur tous les autosomes à l'exception du chromosome focal), ainsi qu'une gamme d'autres traits individuels et effets environnementaux (voir la section « Méthodes » pour plus de détails).

Un GWAS sur le statut ROH allèle peut détecter des allèles récessifs délétères dans des régions spécifiques lorsque les effets ROH atteignent une signification à l'échelle du génome. De plus, la distribution des effets du statut ROH à travers le génome peut également être informative sur le nombre total d'allèles récessifs délétères contribuant à la dépression de consanguinité via ROH. Sous l'hypothèse nulle selon laquelle le statut ROH n'a pas d'effet sur la survie à n'importe quelle position SNP, nous nous attendrions à une distribution 50/50 des estimations négatives et positives du statut ROH en raison du hasard. En revanche, nous avons trouvé beaucoup plus d'effets négatifs que positifs du statut ROH sur la survie à travers le génome que prévu par hasard (Fig. 4a, b 465 K neg. vs. 354 K pos. test binomial exact p = 2,2 * 10 - 16 ). De plus, la proportion d'effets ROH négatifs augmente pour les estimations de modèle plus grandes (Fig. 4a) et plus petites. p-valeurs (Fig. 4b). Nous avons testé cela statistiquement en utilisant deux modèles linéaires généralisés (GLM) binomiaux, avec la direction de l'effet comme réponse binaire, et une estimation du modèle et p-value, respectivement, comme prédicteurs. Les effets ROH étaient plus susceptibles d'être négatifs lorsque leur estimation de modèle était plus grande (log-OR [IC à 95 %] = 0,35 [0,344, 0,358]) et lorsque leur p-valeur était plus petite (log-OR [95 % IC] = -3,82 [-3,84, -3,80]). Par conséquent, il est probable qu'un grand nombre d'allèles délétères récessifs contribuent à la dépression de consanguinité, qui se manifeste par des effets ROH négatifs répartis sur de nombreux loci.

La dépression de consanguinité régionale a été conceptualisée et testée à l'aide de deux prédicteurs binaires du statut ROH. L'un des prédicteurs a quantifié le statut ROH de l'allèle A (dans ROH = 1, pas dans ROH = 0), tandis que l'autre a quantifié le statut ROH de l'allèle B. une Distribution des tailles d'effet pour les effets d'état ROH par rapport au SNP. b Distribution de p-valeurs pour les effets de statut ROH au niveau SNP. Les histogrammes jaunes montrant des effets positifs sont superposés sur les histogrammes violets montrant des effets négatifs pour mettre en évidence une proportion sensiblement plus importante d'effets de statut ROH négatifs que prévu par hasard. c Graphique de Manhattan du statut ROH p-valeurs à travers le génome. La ligne pointillée marque le seuil de signification à l'échelle du génome pour une correction de Bonferroni qui était basée sur le nombre effectif de tests pour tenir compte du déséquilibre de liaison.

Le GWAS a révélé des effets ROH significatifs à l'échelle du génome dans sept régions sur les chromosomes 3 (deux régions), 10, 14, 18, 19 et 23 (Fig. 4c et tableau supplémentaire 5). Dans cinq de ces régions, le statut ROH pour l'un des allèles était associé à des effets négatifs sur la survie, probablement causés par des allèles récessifs relativement fortement délétères. La ROH dans deux autres régions sur les chromosomes 3 et 19 était associée à des probabilités de survie accrues, probablement en raison d'haplotypes ayant des effets positifs sur la survie. To explore the genomic regions with large ROH effects further, we quantified the ROH density and SNP heterozygosity in 2 Mb windows around the top GWAS hits (Supplementary Fig. 8). Strongly deleterious recessive alleles might be expected to occur in regions of elevated heterozygosity where they are rarely expressed in their homozygous state. Heterozygosity was higher than average around the top SNPs on chromosomes 10, 14, 18 and 23, and ROH frequency was lower around the top SNPs on chromosomes 10, 18, 19 and 23, but overall, but we did not observe a convincing pattern of genetic diversity across the five regions harbouring strongly deleterious mutations (Supplementary Fig. 8).


THE GENETIC INTERPRETATION OF INBREEDING DEPRESSION AND OUTBREEDING DEPRESSION

Inbreeding with close relatives and outbreeding with members of distant populations can both result in deleterious shifts in the means of fitness-related characters, most likely for very different reasons. Such processes often occur simultaneously and have important implications for the evolution of mating systems, dispersal strategies, and speciation. They are also relevant to the design of breeding strategies for captive populations of endangered species. A general expression is presented for the expected phenotype of an individual under the joint influence of inbreeding and crossbreeding. This expression is a simple function of the inbreeding coefficient, of source and hybridity indices of crossbreeding, and of specific forms of gene action. Application of the model may be of use in identifying the mechanistic bases for a number of evolutionary phenomena such as the shift from outbreeding enhancement to outbreeding depression that occurs with population divergence.

Mots clés: Inbreeding depression outbreeding depression.


MATÉRIAUX ET MÉTHODES

Study species and populations

Witheringia solanacea is a small shrub that extends from southern Mexico and the Caribbean to South America (D𠆚rcy, 1973). It possesses the gametophytic SI system characteristic of the Solanaceae, where allele-specific S-RNases expressed in the style cause the degradation of RNA, and therefore the death of pollen tubes bearing the cognate S-allele (McClure et al., 1990). The floral biology of W. solanacea is described in detail by Bohs (2000). Its flowers are pollinated by small bees and its fleshy fruits are bird-dispersed. Witheringia solanacea also reproduces prolifically by vegetative reproduction in gardens and along trailsides. Cuttings were collected in the field from Costa Rican populations and maintained in the greenhouse at Colby College. Populations and locations have been described by Stone and Pierce (2005) and Stone et al. (2006). Plants were sampled from populations in three geographic regions. Self-incompatible plants were sampled from large populations in the Las Cruces region, at 1180� m a.s.l. in southwestern Costa Rica, and the Monteverde region in northwestern Costa Rica, extending from 1100 m elevation in the San Luis Valley to 1500 m a.s.l. in the village of Monteverde. The SC individuals came from the very small population at Vara Blanca at 1360 m a.s.l. in central Costa Rica and from the undescribed but morphologically distinct variety at lower elevations in the Monteverde region. Treatments were carried out on seven SI individuals from Las Cruces and 13 from Monteverde, in addition to the two strongly SC individuals available from Vara Blanca and three from Monteverde. The low sample size of SC plants was a consequence of the relative scarcity of the SC phenotype in Monteverde and the tiny overall size of the population in Vara Blanca, which over a decade of monitoring has never been found to contain more than six individuals.

Pollen chase experiment and pollen tube growth

For each trial, we conducted 3𠄶 pairs of SO and OO treatments over a period of 1 week to 10 days. During the summers of 2004�, 48 trials were carried out: seven on SC plants, 14 on Las Cruces plants, and 27 on Monteverde plants. Pollen was collected in clean vials and applied using clean toothpicks to styles of unopened flowers, 24 h before anthesis. Buds at this stage can be identified because they are still tightly closed but have developed the green splotches that decorate the corolla of mature flowers. Pairs of buds were chosen on each recipient, the bud for the SO treatment receiving self-pollen, and the bud for the OO treatment receiving outcross pollen. Twenty-four hours later, outcross pollen from a single compatible donor was applied to both flowers. Previous work in our laboratory has shown that although bud self-pollinations produce fewer pollen tubes at the base of the style than do bud outcross-pollinations, both types of pollinations produce tubes that grow past midstyle at 24 h and reach the base of the style by 48 h. Therefore, we assume that 24 h priority is sufficient to ensure that bud self-pollen tubes reach the base of the style before the subsequent outcross pollen tubes do. In total, 852 pollinations were done, half of which were bud pollinations. Fruits were allowed to ripen, and seeds were counted.

Germination and genotyping

To compare germination rates among treatments for SI populations, we planted seeds from fruits representing all available mothers and cross types. In most instances, 20 seeds were planted per cross, but in some cases all seeds per fruit were planted. We planted five seeds per cell in a 128-cell flat filled with Metro-Mix 200 (Sun-Gro Horticulture, Vancouver, British Columbia, Canada), alternating the position of cells occupied by seeds from SO and OO fruits. Seeds were covered with a fine layer of vermiculite, and the flats were placed in a mist bench under 12-h light/12-h dark in the greenhouse at Colby College. Liquid fertilizer was applied weekly once initial sprouts appeared. Germination was recorded at 6 wk, at which time seedlings were transplanted to individual cells and randomly placed on the bench. Seedlings were harvested by clipping with scissors at ground level at 12 wk and air dried.

To detect the level of self-fertilization resulting from the SO treatment, we used five microsatellite loci to genotype progeny and parental plants. We genotyped 73 progeny from 13 SO pollinations on eight maternal plants. Microsatellite-enriched libraries were developed by Craig Newton of ATG genetics (Vancouver, Washington. USA). We amplified inserts using universal m13 primers, sequenced the inserts using an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, California, USA), and designed primers using the program Primer3 (Rozen and Skaletsky, 2000). Primer sequences appear in Table 1 .

Tableau 1

Primer sequences for microsatellite genotyping of Witheringia solanacea.

NomSequenceTm (ଌ)Product length (bp)Alleles in sample
WsolgataA6Lctgctacccatggctcaact60.28185�6
WsolgataA6Rttttctcggttgcaatggtt60.48
WsolcaA3Lgcaaaatacagtcaacacaatgaa59.10244�2
WsolcaA3Rgctcacgtggtgtttgtaga57.30
WsolcaE1Lcgatccacatcagctgaaaa59.80187�3
WsolcaE1Racccaggaattggggtaaga60.55
WsolcaE2Lgcggatccaggacatgaata60.83209�3
WsolcaE2Rctcctgcgacctgtctgttt60.44
WsolcaE9Ltccctcattggtaagggatg59.74154�4
WsolcaE9Rcgaccagtgctagctgacaa60.20

We extracted genomic DNA using the Qiagen (Germantown, Maryland, USA) DNeasy Plant Mini Kit on 40 mg dried leaf material, using dry ice to keep the tissue brittle for grinding in the Qiagen tissue lyser. PCR was carried out in 25 μL volumes in standard buffer with 1.5 mM MgCl2, 0.8 mM dNTPs, 0.5 μM each primer, 2 U Taq polymerase, and 10 ng genomic DNA. In each reaction, the left primer was fluorescently tagged with 6-FAM. A touchdown PCR program was used, with the annealing temperature decreasing from 60ଌ to 50ଌ by 0.5° each cycle for the first 20 cycles and kept at 50ଌ thereafter. Other PCR conditions were an initial denaturation at 95ଌ for 2.5 min and 35 cycles with 95ଌ for 20 s, annealing for 30 s, and extension at 72ଌ for 30 s with a final extension at 72ଌ for 10 min. PCR products were suspended in deionized formamide with ROX-500 size standard (Applied Biosystems) and run under standard conditions on an ABI 3130 genetic analyzer. Peaks were visualized using GeneScan and scored manually.

L'analyse des données

For the two SI populations, we used a two-way ANOVA to compare fruit and seed set of SO and OO treatments, with population as a random factor and treatment as a fixed factor. Maternal plant was nested within population. Treatment and the population × treatment interaction were tested over treatment × maternal plant nested within the population. To meet assumptions of ANOVA, proportion fruit set was arcsine-transformed, and seed number per plant per treatment was averaged and square-root transformed. The low number of available SC plants made it impossible to evaluate assumptions of parametric tests. For analyses involving SC plants, we used a Wilcoxon’s matched pairs signed rank test for paired comparisons, a Mann–Whitney test for unpaired comparisons, and Kruskal–Wallis tests for comparisons involving all three populations. Nonparametric tests were also used for germination data. Mann–Whitney tests were done by hand, and the program Stata 10.1 (Stata-Corp, College Station, Texas, USA) was used for all other analyses. The cumulative embryonic fitness decline associated with self-precedence was calculated for each individual according to the formula: δ = 1 − (wsf/wde · wss/wos), où wsf = proportion of SO pollinations producing fruit, wde = proportion of OO pollinations producing fruit, wss = average seed number resulting from SO pollinations, wos = average seed number resulting from OO pollinations.

To estimate the selfing rate for SO fruits, we calculated the probability, at each locus, that each offspring was a product of self-fertilization. If any locus revealed a definitive outcrossing event, the progeny was recorded as an out-cross. If no loci revealed definitive outcrossing, the likelihood of selfing was found by multiplying the probabilities across loci.

Pollen tube data, together with selfing rate estimates, allowed us to account for residual SI in the estimate of embryonic inbreeding depression. Bud self-pollination of SI plants from the Monteverde population yielded an average of 37 pollen tubes at the base of the style, whereas bud self-pollination of SI plants from Las Cruces yielded an average of only 13 pollen tubes at the base of the style (Stone et al., 2006). The number of pollen tubes at the base of the style after bud self-pollinations provides the maximum number of selfed seeds that could be expected under bud self-pollination. Any seeds in excess of that expectation should be due to the outcross pollination done on the second day of the pollen chase experiment. An expected selfing rate can therefore be obtained by comparing the number of self-pollen tubes with the total number of seeds. The observed selfing rate of surviving progeny as obtained by microsatellite genotyping was compared with the expected rate to estimate the relative postzygotic fitness of selfed progeny.


What impact has recent inbreeding had on the genetic diversity of domestic dogs?

Research published today in Canine Genetics and Epidemiology investigated the rate of inbreeding in domestic dog breeds recognized by The Kennel Club. Here, Tom Lewis explains more.

The term ‘inbreeding’ is widely associated with severe physiological (and in humans, mental) impairment as a consequence of parents being closely related. As a result, incestuous relationships are a widespread cultural taboo, with laws against incestuous marriages, at least of first degree relatives, almost universally present throughout the world.

However, it is actually very difficult to avoid any degree of relationship between two parents. In part this is due to simple mathematics – the number of ancestors increases exponentially with each generation further back (two parents, four grand-parents, eight great-grand-parents) meaning that it is inevitable there will be some degree of common ancestry if we go back far enough.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

That relatives resemble each other is a central tenet of genetics. Therefore, if we select breeding animals that resemble each other with respect to a particular trait, then these individuals will on average be more closely related than if mating was random.

This means that selection will lead to some degree of inbreeding. Consequently, rather than attempting to avoid any inbreeding in domestic animal populations at all, a more useful strategy is to manage the loss of genetic diversity (rate of inbreeding) to within sustainable levels.

Calculating the rate of inbreeding

The domestic dog shows a greater variety in appearance and behavior than any other domestic species. Many distinct breeds were formed and are maintained by closed registries which have led to the widespread belief that pedigree dogs are very inbred.

Crucially however, the rigorous recording of pedigree data provides large datasets from which genetic parameters and historical trends can be determined, and this information used to guide future breeding strategies.

The rates of inbreeding calculated in all 215 domestic dog breeds recognized by the Kennel Club over the period 1980 to 2014 form the results central to a study recently published in Canine Genetics and Epidemiology. Although the precise profile of rate of loss of genetic diversity is unique for each breed, the study did determine some broad trends.

What did we find?

There was a general contraction of within-breed genetic diversity in the 1980s and 1990s, with the overall rate of inbreeding at a level at which detrimental effects, such as inbreeding depression, would be expected to be observed. However, since the turn of the century the rate of inbreeding has tended to decline across breeds, implying breeders have taken steps to conserve genetic diversity.

Interestingly this general decline in the rate of inbreeding coincides with the relaxation of the UK’s quarantine laws. This suggests that breeders may have taken the opportunity provided by new laws easing travel restrictions for dogs to slow the erosion of genetic diversity, or even re-introduce some genetic variation, through more widespread use of non-UK animals in breeding.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size (as judged by mean number of Kennel Club registrations). This implies that it is possible to conserve genetic diversity via a sustainable rate of inbreeding in small populations, perhaps through judicious use of migrant animals for breeding to provide an injection of genetic diversity to the population.

The existence of popular sires, or male parents, was observed in virtually all pedigree dog breeds in the study. The repeated use of prolific breeding males is both often a feature of selection and a contributor to a high rate of inbreeding, and is typical in breeding practices of almost all domestic mammal species.

Intense selection in males

The much greater reproductive capacity of males compared to females means more intense selection can be applied to males, and the few selected then make a far greater individual genetic contribution to future generations.

While this results in widespread dissemination of genes influencing ‘sought after’ traits (the response to selection), it also makes such males much more likely to be a common ancestor to all breeding animals in subsequent generations, increasing the rate of inbreeding.

The challenge remains, for the dog as for other domestic species, to achieve sufficient response to selection (for traits related to health, temperament, and so on) at a rate of loss of genetic diversity which is sustainable.