Informations

Lors de la conception des amorces, quelle est l'importance de la pince GC ?

Lors de la conception des amorces, quelle est l'importance de la pince GC ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je conçois un ensemble d'amorces et lis sur les principes de la conception d'amorces dont l'un est :

Clamp GC : La présence de bases G ou C dans les cinq dernières bases de l'extrémité 3' des amorces (pince GC) aide à favoriser la liaison spécifique à l'extrémité 3' en raison de la liaison plus forte des bases G et C. Plus de 3 G ou C doivent être évités dans les 5 dernières bases à l'extrémité 3' de l'amorce.

D'ici.

Ma question est de savoir à quel point est-il essentiel d'avoir une pince GC?


Difficile d'apporter une réponse objective. Si vous avez une longueur décente et une bonne complexité, même un seul terminal 3'gouCferait. Bien sûr, il faut tenir compte de l'ensemble de l'amorceGC:ATrapport et des choses comme la température de recuit.

Voici un lien vers divers avis sur le sujet et il a cette pépite (à laquelle je souscris quand c'est possible) :

FWIW, mes offrandes préférées aux dieux de la PCR sont des amorces avec un seul G ou C 3', FWIW. Semble les garder heureux la plupart des phases de la lune.


Je vais offrir mon propre compte (empirique) de la conception des amorces. Une pince GC aide à la spécificité de l'amorçage et contribue donc à l'efficacité globale de la réaction PCR. Dans le passé, j'ai (par nécessité) conçu des amorces qui avaient à la fois trop de serrage GC à l'extrémité 3' et utilisaient des amorces sans aucun serrage GC. Ces réactions PCR ont été réalisées avec succès, avec différents niveaux de formation d'amorces-dimères et d'efficacité globale.

D'après mon expérience, le clampage GC est agréable, mais pas strictement requis pour une bonne PCR. Ma règle générale est de terminer mes amorces avec 2 G/C dans la mesure du possible. Si quelque chose échoue, ce n'est généralement pas le PCR.


Serrage GC à 3', c'est-à-dire avoir un seulgouCà l'extrémité 3' ou quelquesG/Cdans les 6 derniers pb à l'extrémité 3' de l'amorce, peut aider à retenir l'amorce sur le gabarit pendant l'allongement, en raison d'une liaison plus forte par rapport àA=T. Ce n'est pas obligatoire; c'est l'un des caractères de l'amorce qui pourrait améliorer votre réaction PCR.

En même temps, évitez une combinaison séquentielle deCGdans les 6 derniers points de base, ce qui pourrait conduire à des autodimères.

Exemple:
5'-… GCGC-3'a plus de chance de formation de dimères que5'-… GCCG-3'; dans de tels cas, vous pouvez toujours utiliser cette dernière séquence d'amorces.


À moins que vous ne fassiez de la PCR sur quelque chose que vous savez être difficile, utilisez simplement primer3 et ne vous en souciez pas.

http://bioinfo.ut.ee/primer3-0.4.0/


Comment concevoir des amorces pour QPCR

La PCR quantitative ou en temps réel est utilisée comme test de routine pour le suivi des changements relatifs de l'expression génique dans différentes conditions expérimentales. La conception d'amorces ainsi que de sondes pendant la QPCR est l'un des facteurs les plus cruciaux qui affectent la qualité et le succès du test. Plusieurs directives sont applicables pour la conception des amorces pour la QPCR : la teneur en GC des amorces doit être de 35 à 65 % la température de fusion des amorces doit être comprise entre 60 et 68 °C, il faut également éviter les structures secondaires, les répétitions de G ou de C qui sont plus de 3 bases, et la formation d'amorces-dimères.

Domaines clés couverts

1. Qu'est-ce que la QPCR
– Définition, processus, utilisations
2. Comment concevoir des amorces pour QPCR
– Directives pour la conception d'amorces pour la QPCR

Termes clés : colorants fluorescents, contenu GC, température de fusion, amorces, PCR quantitative (QPCR)


Conception de l'amorce - Pince GC

Étant donné que G & C & C se lient plus fortement que A et T, en avoir trop à la fin d'une amorce peut entraîner une augmentation de la Tm et faire en sorte que la pince GC de l'amorce soit trop forte, l'interdisant de dénaturer à la température appropriée. Avoir 1 ou 2 G ou C à la fin de l'amorce est idéal, car cela permet une forte liaison de l'amorce à l'ADNc, le rendant plus spécifique, sans se lier trop fortement.

#3 Tintin

#4 altobarn

#5 wilson_trace

J'utilise un logiciel disponible gratuitement sur Internet pour concevoir des amorces. L'outil me dirait alors si l'amorce est bien conçue ou non. Dans certains cas, je reçois l'avertissement disant ''Il y a plus de 3 G's ou C's dans les 5 dernières bases''. Que se passerait-il si j'avais l'amorce dans ce cas ?

Salut,
Pour autant que je sache, avoir une teneur élevée en GC facilite la liaison étroite de l'oligo à la matrice mais augmente également la possibilité d'un amorçage erroné.
Puis-je savoir quel logiciel utilisez-vous pour vérifier vos amorces ? J'utilise NetPrimer de Primer Biosoft : http://www.premierbi. imer/index.html

#6 phage434

#7 Bassam7

#8 LaLeLi

Cette question sur la pince GC sur les extrémités 3 & 39 des amorces m'intéresse beaucoup.
À l'heure actuelle, j'utilise Primer 3 pour choisir des amorces dans une séquence et dans le champ de paramètre de pince GC, j'ai choisi une pince GC égale à 0, 1 ou 2 et j'ai choisi des amorces pour chaque situation (tout le reste est égal). Les amorces inverses résultantes étaient différentes pour chacune et seule l'amorce directe résultant d'une situation de clamp GC = 0 était différente des autres.

J'ai eu quelques problèmes à essayer d'amplifier ce locus avec les amorces originales conçues pour cela. Ils sont censés fonctionner dans une région conservée (un exon), mais les amplifications que j'ai obtenues n'étaient jamais cohérentes en ce qui concerne l'intensité de la bande amplifiée. J'ai donc décidé d'essayer de choisir d'autres amorces davantage à l'intérieur des exons flanquant ma séquence cible, dans l'espoir d'avoir des amorces fonctionnelles qui pourraient ne pas être soumises à une mutation putative.

Donc, je me demande si les amorces choisies avec GC clamp = 0 forceront une amplification moins spécifique, mais d'autre part augmentera les changements de rendement de tout produit, surtout pour procéder au séquençage par la suite?


Résultats et discussion

Pour déterminer si le GC-clamp doit être attaché à l'extrémité 5' ou 3' de chaque fragment PCR, les cartes de fusion respectives doivent être comparées. A titre d'exemple, nous montrons les courbes de fusion théorique de l'exon 8 du RET gène (Fig. 1A). Lors de la fixation de la pince GC à l'amorce directe, plusieurs domaines de fusion ont été prédits (Fig. 1B). Lorsque, cependant, une pince GC est attachée à l'amorce inverse, un profil de fusion idéal à deux domaines constitué d'un seul domaine de fusion inférieur plat est créé. Cependant, un tel profil de fusion optimal à deux domaines n'est pas trouvé dans toutes les situations. Cela soulève la question de savoir si les fragments PCR avec des tracés de fusion imparfaits peuvent être utilisés pour la détection appropriée des variations de paires de bases et si de simples modifications des fragments PCR/séquences d'amorces peuvent altérer les fragments inappropriés (DGGE) pour qu'ils conviennent à l'analyse DGGE tout en maintenant une analyse optimale. détection de mutations. Dans ce qui suit, nous présentons des exemples d'un certain nombre de ces situations.

Plusieurs domaines de fusion

Lorsqu'un fragment d'ADN avec deux domaines de fusion différents ou plus est séparé par électrophorèse dans un gel DGGE, le fragment sera arrêté à la position dans le gel où la concentration en dénaturant dissocie le fragment à son domaine de fusion le plus bas. Lorsque la mobilité diminue, le fragment peut ne pas atteindre la position dans le gel où le second domaine de fusion fondra. La plupart de ces fragments partiellement fondus apparaissent sous forme de bandes nettes et focalisées, donnant l'idée que le fragment convient à la détection de mutations par DGGE. Lorsque des fragments contiennent deux domaines de fusion (sans tenir compte du GC-clamp), la solution la plus évidente à ce problème est de diviser ce fragment en deux amplicons. Ceci, cependant, n'est pas toujours nécessaire. Pour illustrer que des fragments avec des courbes de fusion imparfaites peuvent être utilisés pour DGGE, nous présentons l'exon 13 du MSH2 gène (Fig. 2A). Lors de l'analyse du fragment avec une pince GC, nous n'avons pu obtenir le graphique de fusion « idéal » que lorsque l'amorce était située dans l'exon. Lors du choix de l'amorce GC-clamped 99 pb en amont de la limite intron-exon, un domaine de fusion inférieur (4 ° C) entre le GC-clamp et le domaine de fusion supérieur 3' du fragment est apparu (Fig. 2B). Ce fragment a fondu sous forme de frottis (Fig. 2C) et une mutation de décalage du cadre de lecture connue (del693T 9) n'a pas pu être détectée (Fig. 2B). Lors du choix d'une amorce GC-clamped 29 pb en amont de la limite intron-exon, le domaine de fusion le plus bas intérieur à l'extrémité 5' du fragment avait un Tm valeur 1,0°C inférieure au deuxième domaine ( Fig. 2E). La mutation del693T a pu être détectée facilement (Fig. 2F).

A partir de cet exemple et de plusieurs cas comparables testés, nous concluons qu'un fragment avec un domaine intérieur de bas point de fusion peut être utilisé pour la DGGE, à condition que le Tm la valeur de ce domaine à bas point de fusion ne diffère pas de plus de 1°C des domaines adjacents et n'est pas supérieure à 50-100 pb de longueur.

Domaines de fusion multiples : cartes de fusion théoriques et analyse expérimentale DGGE pour MSH2 l'exon 13 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 328 pb sans GC-clamp montre deux domaines de température stables. (B) La carte de fusion du fragment avec GC-clamp montre un domaine de fusion intérieur avec un Tm valeur différant de 4°C du second domaine (trait plein). (C) Analyse DGGE de voyage dans le temps du fragment de 328 pb avec le GC-clamp à l'extrémité 5'. La mutation (del693T) n'a pas pu être détectée. () Carte de fusion d'un fragment de 258 pb sans GC-clamp. Une séquence intronique de 70 pb a été retirée de l'extrémité 5' du fragment original de 328 pb. (E) La carte de fusion du fragment de 258 pb avec une pince GC montre un domaine de fusion intérieur ayant un Tm valeur 0,5°C inférieure au deuxième domaine (trait plein). (F) Analyse DGGE de voyage dans le temps du fragment de 258 pb avec le GC-clamp à l'extrémité 5'. La mutation (del693T) pouvait maintenant être détectée.

Domaines de fusion multiples : cartes de fusion théoriques et analyse DGGE expérimentale pour MSH2 l'exon 13 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 328 pb sans GC-clamp montre deux domaines de température stables. (B) La carte de fusion du fragment avec GC-clamp montre un domaine de fusion intérieur avec un Tm valeur différant de 4°C du second domaine (trait plein). (C) Analyse DGGE de voyage dans le temps du fragment de 328 pb avec le GC-clamp à l'extrémité 5'. La mutation (del693T) n'a pas pu être détectée. () Carte de fusion d'un fragment de 258 pb sans GC-clamp. Une séquence intronique de 70 pb a été retirée de l'extrémité 5' du fragment original de 328 pb. (E) La carte de fusion du fragment de 258 pb avec une pince GC montre un domaine de fusion intérieur ayant un Tm valeur 0,5°C inférieure au deuxième domaine (trait plein). (F) Analyse DGGE de voyage dans le temps du fragment de 258 pb avec le GC-clamp à l'extrémité 5'. La mutation (del693T) pouvait maintenant être détectée.

Attachement des nucléotides G/C

Lorsqu'un fragment d'ADN se compose de trois domaines de fusion (comme représenté sur la figure 3A), la détection de mutation n'est possible que dans le domaine de fusion le plus bas et n'est pas possible dans le domaine supérieur (non fondu). Lorsque ce domaine de fusion le plus bas est court, <50 pb, et se trouve sur l'une des extrémités du fragment (Fig. 3A), une solution pour cette condition est l'ajout d'un tronçon de nucléotides G/C (trois à sept) à cette extrémité du fragment à travers l'amorce courte. Cet apprêt modifié augmentera la Tm valeur du petit domaine de fusion le plus bas et ainsi favoriser l'établissement du profil à deux domaines souhaité. Pour illustrer les résultats de l'ajout de résidus G et/ou C à l'amorce courte, nous avons examiné l'exon 7 du BRCA2 gène (Fig. 3A). Pour déterminer le comportement de fusion du fragment, nous avons introduit une mutation dans l'amorce sens (10). Les fragments sans extension ajoutée de nucléotides GC ont montré une réduction de mobilité et sont apparus comme une seule bande focalisée nette après 5 h d'électrophorèse à 150 V (figure 3B). Les résultats ne peuvent être interprétés que comme une absence de mutations dans ce fragment. Lorsque trois bases (CGC) ont été attachées à l'extrémité 3' du fragment, par l'intermédiaire de l'amorce courte inverse, la carte de fusion calculée de ce fragment a prédit que la Tm du domaine de fusion la plus basse différerait de ∼1°C de l'autre domaine (Fig. 3C). Bien que la courbe de fusion ne soit pas optimale, la mutation a pu être détectée après 7 à 8 h d'électrophorèse à 150 V ( Fig. 3D). Lorsque cinq ou sept bases ont été ajoutées à l'extrémité 3' du fragment, le profil théorique à deux domaines souhaité a été créé et la mutation a été résolue après 6 à 7 h d'électrophorèse à 150 V (données non présentées).

Attachement des nucléotides G/C : cartes de fusion théoriques et analyse DGGE expérimentale pour BRCA2 l'exon 7 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 203 pb sans (ligne continue) et avec GC-clamp (ligne pointillée) montre plusieurs domaines de fusion. (B) Analyse DGGE du temps-voyage du fragment de 203 pb. Le fragment apparaît comme une seule bande focalisée et la mutation n'a pas pu être détectée. (C) La carte de fusion du fragment sans (ligne continue) et avec une pince GC (ligne pointillée) montre que le Tm la valeur du domaine de fusion la plus basse ne diffère que de ∼1°C de l'autre domaine lorsque trois bases (GCG) sont ajoutées à l'extrémité 3'. () Analyse DGGE de voyage dans le temps du fragment avec trois bases (GCG) ajoutées à l'amorce courte inverse. La mutation est facilement détectée.

Attachement des nucléotides G/C : cartes de fusion théoriques et analyse DGGE expérimentale pour BRCA2 l'exon 7 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 203 pb sans (ligne continue) et avec GC-clamp (ligne pointillée) montre plusieurs domaines de fusion. (B) Analyse DGGE du temps-voyage du fragment de 203 pb. Le fragment apparaît comme une seule bande focalisée et la mutation n'a pas pu être détectée. (C) La carte de fusion du fragment sans (ligne continue) et avec une pince GC (ligne pointillée) montre que le Tm la valeur du domaine de fusion la plus basse ne diffère que de ∼1°C de l'autre domaine lorsque trois bases (GCG) sont ajoutées à l'extrémité 3'. () Analyse DGGE de voyage dans le temps du fragment avec trois bases (GCG) ajoutées à l'amorce courte inverse. La mutation est facilement détectée.

Ainsi, sur la base de calculs informatiques et d'expérimentations pratiques, nous proposons que la fixation d'un petit tronçon de nucléotides G/C à l'amorce courte peut améliorer la détection des mutations dans ces conditions. Il convient toutefois de noter que l'étirement des nucléotides G/C ne doit pas dépasser 10 bases, car cela introduira une petite partie très riche en GC dans le fragment, entraînant des frottis ou des bandes diffuses dans un gel DGGE (données non présentées ).

Attachement des nucléotides A/T

Lorsque les informations de séquence sont limitées, il peut être impossible de sélectionner des amorces sans avoir un domaine riche en GC à proximité du site de fixation GC-clamp du fragment (figure 4A). En conséquence, des mutations dans ces domaines de fusion plus élevée seront manquées. Nous avons émis l'hypothèse que l'insertion d'un tronçon de 15 à 20 nucléotides T entre la pince GC et l'amorce spécifique pourrait diminuer la Tm valeur de la séquence riche en GC et ainsi rendre possible la détection de mutations dans le domaine de fusion supérieur. Pour tester cela, nous avons examiné l'exon 9 du MSH2 gène (figure 4A). Pour obtenir le profil de fusion à deux domaines (théoriquement) souhaité, 20 nucléotides T devaient être insérés à l'extrémité 3' ou 15 nucléotides T à l'extrémité 5' entre la pince GC et l'amorce spécifique (Fig. 4C). Pour tester cela, nous avons examiné une substitution g → t située au site accepteur d'épissage dans l'intron 8 ( 9) présent dans un domaine de fusion élevée. Comme prévu, étant donné son emplacement dans la partie hautement riche en GC à la position -1 du nucléotide (Fig. 4A), la mutation n'a pas pu être détectée lorsque le GC-clamp était directement attaché à l'amorce directe (Fig. 4B). La mutation, cependant, a été détectée lorsque 15 nucléotides T ont été insérés entre la pince GC et l'amorce directe (Fig. 4D).

Attachement de nucléotides A/T : cartes de fusion théoriques et analyse expérimentale DGGE pour MSH2 l'exon 9 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 208 pb avec une pince GC des deux côtés montre des domaines de fusion élevée de chaque côté. (B) Analyse DGGE du temps-voyage du fragment de 208 pb avec le GC-clamp à l'extrémité 5'. Une mutation du site d'épissage située dans le domaine de fusion élevée n'a pas pu être détectée. (C) La carte de fusion du fragment montre un profil de fusion optimal à deux domaines lorsque 20 nucléotides T sont insérés entre l'amorce inverse et la pince GC (ligne pointillée) ou 15 nucléotides T entre l'amorce directe et la pince GC (ligne continue) . () Analyse DGGE de voyage dans le temps du fragment de 208 pb avec 15 nucléotides T entre l'amorce directe et le GC-clamp. La mutation est clairement visible.

Attachement de nucléotides A/T : cartes de fusion théoriques et analyse expérimentale DGGE pour MSH2 l'exon 9 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 208 pb avec une pince GC des deux côtés montre des domaines de fusion élevée de chaque côté. (B) Analyse DGGE du temps-voyage du fragment de 208 pb avec le GC-clamp à l'extrémité 5'. Une mutation du site d'épissage située dans le domaine de fusion élevée n'a pas pu être détectée. (C) La carte de fusion du fragment montre un profil de fusion optimal à deux domaines lorsque 20 nucléotides T sont insérés entre l'amorce inverse et la pince GC (ligne pointillée) ou 15 nucléotides T entre l'amorce directe et la pince GC (ligne continue) . () Analyse DGGE de voyage dans le temps du fragment de 208 pb avec 15 nucléotides T entre l'amorce directe et le GC-clamp. La mutation est clairement visible.

L'insertion de nucléotides T entre le GC-clamp et l'amorce spécifique permet la détection de mutations dans de petites régions très riches en GC à proximité de l'amorce GC-clamp.

Domaine de fusion élevée à l'extrémité d'un fragment d'ADN : cartes de fusion théoriques et analyse expérimentale DGGE pour RET l'exon 13 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 278 pb sans GC-clamp (ligne continue) montre un domaine de fusion élevée à l'extrémité 3'. Un profil idéal à deux domaines est obtenu en attachant une pince GC à l'extrémité 5' (ligne pointillée). (B) Analyse DGGE de voyage dans le temps du fragment de 278 pb avec un domaine de fusion élevée à l'extrémité 3'. Le fragment a donné des bandes indistinctes et la mutation (S767R) n'a pas pu être détectée. (C) La carte de fusion d'un fragment de 234 pb sans GC-clamp (ligne continue) montre un seul domaine de fusion. Une séquence intronique de 44 pb a été retirée de l'extrémité 3' du fragment de 278 pb. La carte de fusion du fragment de 234 pb avec GC-clamp (ligne pointillée) montre deux domaines avec des propriétés légèrement différentes Tm. () Analyse DGGE du temps de voyage du fragment de 234 pb sans domaine de fusion élevée à l'extrémité 3'.La mutation (S767R) est clairement visible.

Domaine de fusion élevée à l'extrémité d'un fragment d'ADN : cartes de fusion théoriques et analyse expérimentale DGGE pour RET l'exon 13 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 278 pb sans GC-clamp (ligne continue) montre un domaine de fusion élevée à l'extrémité 3'. Un profil idéal à deux domaines est obtenu en attachant une pince GC à l'extrémité 5' (ligne pointillée). (B) Analyse DGGE de voyage dans le temps du fragment de 278 pb avec un domaine de fusion élevée à l'extrémité 3'. Le fragment a donné des bandes indistinctes et la mutation (S767R) n'a pas pu être détectée. (C) La carte de fusion d'un fragment de 234 pb sans GC-clamp (ligne continue) montre un seul domaine de fusion. Une séquence intronique de 44 pb a été retirée de l'extrémité 3' du fragment de 278 pb. La carte de fusion du fragment de 234 pb avec GC-clamp (ligne pointillée) montre deux domaines avec des propriétés légèrement différentes Tm. () Analyse DGGE du temps de voyage du fragment de 234 pb sans domaine de fusion élevée à l'extrémité 3'. La mutation (S767R) est clairement visible.

Domaine de fusion élevée à l'extrémité d'un fragment d'ADN

Nous avons rencontré plusieurs amplicons avec des courbes de fusion parfaites (fragments avec GC-clamp) qui, cependant, lors de l'électrophorèse dans un gel DGGE ont entraîné des frottis ou des bandes diffuses. Lors de l'analyse de la courbe de fusion des séquences natives (fragments sans GC-clamp), nous avons observé qu'un domaine de fusion élevée était présent à une extrémité du fragment. L'effet de ce domaine de fusion élevée sur la détection de mutations par DGGE peut être illustré par une analyse de l'exon 13 de la RET gène (Fig. 5A). L'analyse DGGE d'une substitution T→G (S767R) dans l'exon 13 du RET gène situé à la position nucléotidique 18 du fragment montre que seules des bandes indistinctes peuvent être observées (figure 5B). Cela démontre un écart entre le graphique de fusion théorique calculé par MELT87 et le comportement de fusion «réel» pratique du fragment PCR. Le moyen le plus simple de résoudre ce problème est de supprimer la séquence riche en GC. Dans ce cas, nous pourrions retirer 44 pb de l'extrémité 3' du fragment sans retirer aucune de la séquence codante. Bien que la courbe de fusion théorique ne soit pas parfaite (figure 5C), la figure 5D montre quatre bandes distinctes. Des données théoriques et des observations pratiques similaires ont été obtenues pour les exons 14 et 15 de la RET gène (données non présentées). Puisqu'il a été rapporté qu'un court tronçon de séquence riche en AT pourrait diminuer la Tm valeur d'une petite région riche en GC (11), nous avons essayé de résoudre le problème mentionné ci-dessus en introduisant un tronçon de sept nucléotides AT à l'extrémité 3' de l'amorce courte inverse. Cela n'a cependant pas été un succès (données non présentées). L'utilisation d'un tronçon plus long de nucléotides AT (>20 nt) introduira un domaine à faible point de fusion résultant en une structure à trois domaines non optimale.

Domaine de fusion élevée au milieu d'un fragment : carte de fusion théorique et analyse expérimentale DGGE pour CFTR l'exon 2 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 217 pb sans GC-clamp (ligne continue) montre un domaine de fusion élevée dans la partie médiane de ce fragment. Un profil idéal à deux domaines est obtenu en attachant une pince GC à l'extrémité 3' (ligne pointillée). (B) L'analyse DGGE du fragment de 217 pb révèle la détection des trois mutations par la présence de trois ou quatre bandes. Les pistes 1 à 4 montrent un échantillon témoin, 186-13c→g, 241delAT et 296+2t→c, respectivement.

Domaine de fusion élevée au milieu d'un fragment : carte de fusion théorique et analyse expérimentale DGGE pour CFTR l'exon 2 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 217 pb sans GC-clamp (ligne continue) montre un domaine de fusion élevée dans la partie médiane de ce fragment. Un profil idéal à deux domaines est obtenu en attachant une pince GC à l'extrémité 3' (ligne pointillée). (B) L'analyse DGGE du fragment de 217 pb révèle la détection des trois mutations par la présence de trois ou quatre bandes. Les pistes 1 à 4 montrent un échantillon témoin, 186-13c→g, 241delAT et 296+2t→c, respectivement.

Longueur de la pince GC : carte de fusion théorique et analyse expérimentale DGGE pour RET l'exon 5 et ses séquences introniques flanquantes. (UNE) Les cartes de fusion d'un fragment de 295 pb avec un GC-clamp de 40 (ligne continue) et de 60 pb (ligne pointillée) montrent des profils de fusion similaires. (B) Analyse DGGE de voyage dans le temps du fragment de 295 pb avec un GC-clamp de 40 pb. Le fragment apparaît sous forme de bandes diffuses après 8 h d'électrophorèse à 150 V. (C) Analyse DGGE de voyage dans le temps du fragment de 295 pb avec une pince GC de 60 pb. Le fragment donne une bande fortement focalisée.

Longueur de la pince GC : carte de fusion théorique et analyse expérimentale DGGE pour RET l'exon 5 et ses séquences introniques flanquantes. (UNE) Les cartes de fusion d'un fragment de 295 pb avec une GC-clamp de 40 (ligne continue) et de 60 pb (ligne pointillée) montrent des profils de fusion similaires. (B) Analyse DGGE de voyage dans le temps du fragment de 295 pb avec un GC-clamp de 40 pb. Le fragment apparaît sous forme de bandes diffuses après 8 h d'électrophorèse à 150 V. (C) Analyse DGGE de voyage dans le temps du fragment de 295 pb avec une pince GC de 60 pb. Le fragment donne une bande fortement focalisée.

Si l'analyse de fusion d'un fragment court (<200 pb) prédit un domaine de fusion élevée <40 pb en taille situé à l'extrémité du fragment et ne différant pas de plus de 5°C en Tm valeur, ce fragment convient très probablement à l'analyse DGGE. Cependant, lorsqu'un domaine de fusion élevée (>50 pb en taille et différant du reste de ∼5°C en Tm valeur) est situé à une extrémité d'un fragment d'ADN, il peut affecter de manière significative le comportement de fusion du fragment même après la fixation d'une pince GC.

Pince naturelle : cartes de fusion théoriques et analyse DGGE expérimentale pour MSH2 l'exon 1 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 271 pb avec une pince GC de 40 pb à l'extrémité 5' (ligne pointillée) montre un profil idéal à deux domaines. (B) Analyse DGGE de voyage dans le temps du fragment de 271 pb avec le GC-clamp de 40 pb. Le fragment est devenu complètement monocaténaire et a coulé du gel après 7 h d'électrophorèse à 150 V. (C) La carte de fusion d'un fragment de 299 pb sans GC-clamp (ligne continue) montre un domaine naturel de fusion élevée d'environ 60 pb à l'extrémité 3'. Carte de fusion du fragment de 299 pb avec une pince GC de 55 pb montrant un domaine de fusion élevée d'environ 100 pb à l'extrémité 3'. () Analyse DGGE de voyage dans le temps du fragment de 299 pb avec le GC-clamp de 55 pb. Le fragment donne une seule bande nette après 9 h d'électrophorèse à 150 V.

Pince naturelle : cartes de fusion théoriques et analyse DGGE expérimentale pour MSH2 l'exon 1 et ses séquences introniques flanquantes. (UNE) La carte de fusion d'un fragment de 271 pb avec une pince GC de 40 pb à l'extrémité 5' (ligne pointillée) montre un profil idéal à deux domaines. (B) Analyse DGGE de voyage dans le temps du fragment de 271 pb avec le GC-clamp de 40 pb. Le fragment est devenu complètement monocaténaire et a coulé du gel après 7 h d'électrophorèse à 150 V. (C) La carte de fusion d'un fragment de 299 pb sans GC-clamp (ligne continue) montre un domaine naturel de fusion élevée d'environ 60 pb à l'extrémité 3'. Carte de fusion du fragment de 299 pb avec une pince GC de 55 pb montrant un domaine de fusion élevée d'environ 100 pb à l'extrémité 3'. () Analyse DGGE de voyage dans le temps du fragment de 299 pb avec le GC-clamp de 55 pb. Le fragment donne une seule bande nette après 9 h d'électrophorèse à 150 V.

Domaine de fusion élevée au milieu d'un fragment

D'après ce qui précède, il est clair que lors de la conception d'un système de détection de mutation DGGE, les courbes de fusion des fragments fixés et non fixés doivent être examinées. Dans plusieurs cas, nous avons trouvé un domaine riche en GC au milieu d'un fragment, visible sous la forme d'un pic dans le profil de fusion de la séquence native, mais pas vu après l'ajout d'un GC-clamp (Fig. 6A). Pour déterminer si un domaine de fusion aussi élevé a une influence sur la détection de mutations dans le domaine, nous avons examiné CFTR exon 2, dont la carte de fusion avec et sans pince 3'-GC est représentée sur la figure 6A. Nous avons examiné trois mutations connues situées au milieu de ce fragment : 186-13c→g à la position nucléotidique -13 241delAT à la position nucléotidique 39 du fragment, située dans le pic du domaine de fusion (79°C) 296+2t→c à la position nucléotidique +2 (figure 6A). La figure 6B montre une analyse DGGE des trois mutations dans l'exon 2 du CFTR gène. Les trois mutations ont été facilement détectées. Des données théoriques et des observations pratiques similaires ont été obtenues pour l'exon 5 du TP53 gène, qui a un pic un peu plus large au milieu du fragment (données non présentées). Ainsi, les mutations situées dans de tels domaines de fusion élevée ne posent pas de problème pour la détection.

Pour la DGGE, des fragments de PCR de préférence courts (<300 pb) doivent être choisis, car une pince GC a un effet plus important sur les propriétés de fusion des fragments courts. Des fragments adaptés à la DGGE peuvent ainsi être générés plus facilement. Dans les fragments longs (>400 pb), un grand domaine interne de fusion élevée (100 pb) peut avoir un impact substantiel, car la pince GC a relativement peu d'effet sur le comportement de fusion de la partie centrale, par exemple, l'exon 4 du TP53 gène (11). Mutations situées dans le domaine de fusion élevée (100 pb de long, différant de 6°C en Tm valeur) et dans le domaine entre ce domaine de fusion élevée et GC-clamp n'a pas pu être détecté en utilisant un seul fragment PCR dans DGGE (données non présentées).

Nous concluons que tandis que la présence d'un domaine de fusion élevée au milieu d'un petit fragment (<300 pb) permet toujours une bonne analyse de mutation, sa présence au milieu d'un grand fragment PCR (>400 pb) rend le fragment impropre à l'analyse DGGE .

Longueur de la pince GC

Plusieurs études (3, 5) ont indiqué qu'un GC-clamp aussi court que 30 pb serait suffisant en DGGE. Cela peut être vrai pour les fragments riches en AT, mais pour une séquence riche en GC, la différence de Tm avec une pince GC peut devenir trop petite. Même la pince GC standard de 40 pb peut ne pas être suffisante pour empêcher la dissociation totale des brins. Ici, nous démontrons l'effet de la longueur du GC-clamp sur les fragments riches en GC avec l'exon 5 du RET gène à titre d'exemple. L'analyse de fusion du fragment a révélé une Tm valeur de 80°C. La fixation de pinces GC de 40 et 60 pb à l'extrémité 3' du fragment a donné des profils de fusion théoriques similaires (figure 7A). Le fragment avec le GC-clamp de 40 pb devient complètement monocaténaire et s'écoule du gel (Fig. 7B et aussi Fig. 8A et B), tandis que le fragment GC-clamp de 60 pb a fondu en une seule bande pointue (Fig. 7C ).

Pour les séquences extrêmement riches en GC (Tm > 80°C), comme c'est généralement le cas pour le premier exon de la plupart des gènes, la différence de Tm les valeurs entre le GC-clamp et la séquence cible peuvent être si faibles que même un GC-clamp de 60 pb peut ne pas être suffisant pour empêcher la dissociation totale des brins, bien que la courbe de fusion puisse être parfaite. Si possible, un domaine naturel à point de fusion élevé en combinaison avec une pince GC plus longue peut être utilisé (Fig. 8C). A titre d'exemple, nous montrons l'exon 1 du MSH2 gène (Fig. 8A–D). Lors de l'analyse du comportement de fusion d'un fragment de 299 pb, un domaine naturel à fusion élevée d'environ 60 pb à l'extrémité 3' du fragment devient visible (Fig. 8C). En ajoutant une pince GC de 55 pb à l'extrémité 3' de cette molécule, un domaine de fusion élevée d'environ 100 pb a été créé (Fig. 8C). Lors de l'exécution de ce fragment de PCR dans un gel DGGE, il en a résulté une fusion d'une seule bande nette à une concentration d'UF appropriée (figure 8D).

Nous concluons que pour les fragments avec un Tm valeur proche de 80°C, une pince GC d'une longueur de 60 pb améliorera la détection des mutations. DGGE pour les fragments avec un Tm La valeur >80°C n'est possible qu'en utilisant une longue pince GC en combinaison avec un domaine riche en GC "naturellement".


CONCEPTION AMORCES PCR

INFORMATIONS D'ARRIÈRE-PLAN: Pour les sites décrivant la théorie de la PCR, ainsi que les entreprises commercialisant des produits PCR, vous pouvez commencer par visiter Highveld. Pour les techniques de PCR, voir PCRlink.com.

Il existe plusieurs excellents sites pour concevoir des amorces PCR :

Primer3 : outil d'amorce WWW (École de médecine de l'Université du Massachusetts, États-Unis) &ndash Ce site dispose d'un programme de conception d'amorces PCR très puissant permettant un contrôle considérable sur la nature des amorces, y compris la taille du produit souhaité, la taille de l'amorce et la plage de Tm, et la présence/absence d'une pince 3&rsquo-GC.
GeneFisher - Conception d'amorces PCR interactives (Université de Bielefeld, Allemagne) - un très bon site permettant un grand contrôle sur la conception des amorces.

Primer3Plus - une nouvelle interface Web améliorée pour le programme de conception d'amorces populaire Primer3 (Référence : A. Untergasser et al. 2007. Nucl. Acids Res. 35(Problème de serveur Web) : W71-W74)
Outil de conception et de recherche d'amorces BiSearch - il s'agit d'un outil utile pour la conception d'amorces pour n'importe quelle matrice d'ADN et en particulier pour les génomes traités au bisulfite. L'outil ePCR permet une détection rapide des sites d'amorçage erroné et des produits de PCR alternatifs dans les bibliothèques d'ADNc et les génomes natifs ou traités au bisulfite. (Référence : Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST a été développé au NCBI pour aider les utilisateurs à créer des amorces spécifiques au modèle PCR d'entrée. Il utilise Primer3 pour concevoir des amorces PCR, puis les soumet à la recherche BLAST par rapport à la base de données sélectionnée par l'utilisateur. Les résultats de l'explosion sont ensuite automatiquement analysés pour éviter les paires d'amorces qui peuvent provoquer l'amplification de cibles autres que la matrice d'entrée.

MFEprimer permet aux utilisateurs de vérifier rapidement et facilement la spécificité des amorces par rapport à l'ADN génomique et aux bases de données de séquences d'ADN messager/ARN messager. Ce serveur utilise un algorithme d'index k-mer pour accélérer le processus de recherche de sites de liaison d'amorce et utilise la thermodynamique pour évaluer la stabilité de liaison entre chaque amorce et sa matrice d'ADN. Plusieurs caractéristiques importantes, telles que la séquence, la température de fusion et la taille de chaque amplicon, spécifique ou non spécifique, sont rapportées. (Référence : Qu W et al. 2012. Nucl. Acids Res. 40 (Problème de serveur Web) : W205-W208)

Outil de conception et de recherche d'amorces

PrimerDesign-M - comprend plusieurs options pour la conception d'amorces multiples, permettant aux chercheurs de concevoir efficacement des amorces de marche qui couvrent de longues cibles d'ADN, telles que des génomes entiers du VIH-1, et qui optimisent les amorces simultanément informées par la diversité génétique dans plusieurs alignements et les contraintes de conception expérimentale donné par l'utilisateur. PrimerDesign-M peut également concevoir des amorces qui incluent des codes-barres ADN et minimisent la dimérisation des amorces. PrimerDesign-M trouve des amorces optimales pour des cibles d'ADN très variables et facilite la flexibilité de conception en suggérant des conceptions alternatives pour s'adapter aux conditions expérimentales. (Référence : Yoon H & Leitner T. 2015. Bioinformatique 31:1472-1474).

Clonage RF (clonage sans restriction) - est une technologie basée sur la PCR qui étend le processus de mutagenèse QuikChange&trade popularisé à l'origine par Stratagene au milieu des années 1990, et permet l'insertion de pratiquement n'importe quelle séquence dans n'importe quel plasmide à n'importe quel endroit. (Référence : Bond SR & Naus CC. 2012. Nucl. Acids Res 40(Problème de serveur Web) : W209-W213)

primers4clades - est un pipeline pour la conception d'amorces PCR pour l'amplification inter-espèces de nouvelles séquences à partir d'ADN métagénomique ou d'organismes non caractérisés appartenant à des lignées phylogénétiques spécifiées par l'utilisateur. Il met en œuvre une stratégie CODEHOP étendue basée sur des alignements multiples d'ADN et de protéines de gènes codants et évalue les propriétés thermodynamiques des paires d'oligonucléotides, ainsi que le contenu en information phylogénétique des amplicons prédits, calculé à partir des valeurs de support de branche des phylogénies de vraisemblance maximale. Les arbres affichés à l'écran facilitent le ciblage des amorces vers des clades sélectionnés de manière interactive. (Référence : Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Problème de serveur Web) : W95-W100).

TaxMan : inspectez vos amplicons d'ARNr et vos attributions de taxons - Dans les analyses de microbiome, les bases de données de gènes d'ARNr sont souvent utilisées pour attribuer des noms taxonomiques aux lectures de séquences. Le serveur TaxMan facilite l'analyse de la répartition taxonomique de vos lectures de deux manières. Tout d'abord, vous pouvez vérifier quels noms taxonomiques sont attribués aux séquences produites par vos amorces et quels taxons vous perdrez. Deuxièmement, les séquences d'amplicons produites avec des lignées dans l'en-tête FASTA peuvent être téléchargées. Cela peut entraîner une analyse beaucoup plus efficace en ce qui concerne le temps d'exécution et l'utilisation de la mémoire, car les séquences d'amplicons sont considérablement plus courtes que les séquences de gènes d'ARNr pleine longueur. De plus, vous pouvez télécharger un fichier de lignée qui comprend les dénombrements de tous les taxons pour vos amorces et pour la référence utilisée. (Référence : Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Paramètres physico-chimiques des oligonucléotides :

NetPrimer (Premier Biosoft International, États-Unis) - À mon avis, le meilleur site car il en fournit un avec Tm, des propriétés thermodynamiques et des dimères en épingle à cheveux et ampli les plus stables. MAIS il faut un certain temps pour que le programme se charge.

dnaMATE - calcule un consensus Tm pour une séquence d'ADN courte (16-30 nts) en utilisant une méthode fusionnée basée sur trois tables thermodynamiques différentes. La valeur de consensus Tm est une estimation robuste et précise de la température de fusion pour de courtes séquences d'ADN d'application pratique en biologie moléculaire. Les références de précision utilisant toutes les données expérimentales disponibles indiquent que les erreurs de prédiction de consensus Tm seront à moins de 5 ºC de la valeur expérimentale dans 89% des cas. (Référence : A. Panjkovich et al. 2005. Nucl. Acides Rés. 33: W570-W572.).

OligoCalc - un calculateur de propriétés d'oligonucléotides en ligne - ( Référence : W.A. Kibbe. 2007. Nucl. Acids Res. 35 (Web Server issue) : W43-W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc )
Calculateur de masse Mongo Oligo v2.06
OligoEvaluateur (Sigma-Aldrich)
Outil de calcul Oligo (Genescript, États-Unis) - permet de modifier

Amorces PCR basées sur la séquence protéique :

Si vous avez la séquence de protéines et que vous voulez la séquence d'ADN, les meilleurs sites sont la traduction inverse de protéine en ADN ou la partie traduction inverse de la suite de manipulation de séquence. Si vous souhaitez changer un acide aminé spécifique en un autre, vous devriez consulter Primaclade (Référence : Gadberry MD et al. 2005. Bioinformatics 21:1263-1264).

PCR et clonage :

AMUSEUR (UNEADN automatisé Modifications avec UTILISATEUR clonage) offre une conception rapide et facile d'amorces PCR optimisées pour diverses ingénieries d'ADN basées sur le clonage d'UTILISATEURS. Le clonage USER est une méthode rapide et polyvalente pour l'ingénierie de l'ADN plasmidique. Cet outil de serveur Web automatise la conception d'amorces PCR optimales pour plusieurs applications distinctes basées sur le clonage USER.Il facilite l'assemblage d'ADN et l'introduction de pratiquement tout type de mutagenèse dirigée en concevant des amorces PCR optimales pour les changements génétiques souhaités. (Référence : Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Amorces à l'échelle génomique : (N.B. voir aussi la page JAVA pour des programmes téléchargeables supplémentaires)

La suite PCR (Klinische Genetica, Erasmus MC Rotterdam, Pays-Bas) - il s'agit d'une suite de quatre programmes basés sur Primer3 pour la conception d'amorces génomiques. Tous offrent un contrôle considérable sur les propriétés des apprêts :

Overlapping_Primers - crée plusieurs produits PCR qui se chevauchent en une seule séquence.
Genomic_Primers - conçoit des amorces autour des exons dans la séquence génomique. Tout ce dont vous avez besoin est un fichier GenBank contenant votre gène.
SNP_Primers - conçoit des amorces autour de chaque SNP dans un fichier GenBank.
cDNA_Primers - conçoit des amorces autour de cadres de lecture ouverts. Téléchargez simplement un fichier GenBank contenant vos gènes.

Jeux d'amorces superposés :

Deux sites proposent un logiciel basé sur le programme Primer3 pour la conception de jeux de paires d'amorces PCR qui se chevauchent - Conception d'amorces multiples avec Primer 3 et jeux d'amorces superposés

PHUSER (Primeur Haide pour UTILISATEUR ) - La fusion Uracil-Specific Exision Reagent (USER) est une technique récemment développée qui permet l'assemblage de plusieurs fragments d'ADN en quelques étapes simples. PHUSER offre une conception rapide et facile d'amorces optimisées pour la PCR assurant une fusion directionnelle correcte des fragments dans un plasmide contenant une cassette USER personnalisable. Les amorces ont une température de recuit similaire (Tm). PHUSER évite également les surplombs identiques, assurant ainsi un ordre correct d'assemblage des fragments d'ADN. Toutes les amorces possibles sont analysées individuellement en termes de contenu GC, de présence de pince GC à l'extrémité 3 & 39, de risque de formation de dimères d'amorces, de risque de structures secondaires intra-amorces et de présence d'étirements polyN. (Référence : Olsen LR et al. 2011. Nucl. Acids Res. 39 (Problème de serveur Web) : W61-W70)

Primerize est un serveur Web pour la conception d'amorces d'assemblage PCR de séquences d'ADN. Primerize est optimisé pour réduire les erreurs d'amorçage des limites des amorces, est conçu pour des séquences fixes de problèmes d'ARN et a réussi des tests larges et rigoureux. Cet algorithme efficace est adapté à une utilisation étendue telle que la bibliothèque de mutagenèse massivement parallèle. (Référence : Tian, ​​S., & Das, R. (2016) Revue trimestrielle de biophysique 49(e7) : 1-30).

Conception d'ARN interférent court (siARN) :

Les petits ARN interférents (ARNsi) guident la dégradation spécifique à la séquence de l'ARNm homologue, produisant ainsi des cellules « knock-down ». L'outil de conception de siRNA scanne un gène cible pour les séquences de siRNA candidates qui satisfont aux règles réglables par l'utilisateur. Une variété de serveurs existe :

Logiciel de conception siRNA - compare les outils de conception existants, y compris ceux énumérés ci-dessus. Ils tentent également d'améliorer les principes MPI et les outils existants par un algorithme capable de filtrer les siARN inefficaces. L'algorithme est basé sur de nouvelles observations sur la structure secondaire. ( Référence: S.M. Yiu et al. (2004) Bioinformatique 21: 144-151).

OligoWalk est un serveur en ligne calculant les caractéristiques thermodynamiques de l'hybridation sens-antisens. Il prédit les changements d'énergie libre des oligonucléotides se liant à un ARN cible. Il peut être utilisé pour concevoir un ARNsi efficace ciblant une séquence d'ARNm donnée. (Référence : Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - un serveur de prédiction de l'efficacité du siRNA viral humain (Référence : Qureshi A et al. 2013. J Transl Med. 11:305).

Les siRNA Dicer-substrat (DsiRNA) sont des ARN duplex 27-mères synthétisés chimiquement qui ont une puissance accrue en interférence ARN par rapport aux siRNA traditionnels. RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Concevoir des siRNA d'ARNi de plantes efficaces et spécifiques avec une évaluation des gènes hors cible à l'échelle du génome.

DSIR est un outil pour la conception de cibles siRNA (19 ou 21 nt) et shRNA. (Référence : Vert JP et al. 2006. BMC Bioinformatics 7:520).

Le programme Imgenex siRNA retriever a été conçu pour sélectionner des oligonucléotides d'ADN codant pour les siRNA qui peuvent être clonés dans l'un des vecteurs pSuppressor. La séquence d'entrée est directement accessible à partir d'une accession ou d'une séquence Genbank fournie par le chercheur.

siDRM est une implémentation des ensembles de règles DRM pour sélectionner des siARN efficaces. Les auteurs ont effectué une analyse mise à jour à l'aide de l'approche de fusion de règles disjonctives (DRM) sur un ensemble de données vaste et diversifié compilé à partir de siRecords, et ont implémenté les ensembles de règles résultants dans siDRM, un nouvel outil de conception de siRNA en ligne. siDRM implémente également quelques ensembles de règles à haute sensibilité et des ensembles de règles rapides, des liens vers siRecords, et utilise plusieurs filtres pour vérifier les effets néfastes indésirables, y compris les réponses immunitaires innées, les effets toxiques cellulaires et les activités hors cible dans la sélection des siARN. (Référence : Gong W et al. 2008. Bioinformatique 24:2405-2406).

Outil de conception d'ARNsi siMAX (Eurofins Genomic, Allemagne) - est un logiciel développé propriétaire conçu pour vous aider à sélectionner le siRNA le plus approprié ciblant votre (vos) gène(s) d'intérêt.

Concepteur shRNA (Biosettia Inc., États-Unis) - Utilisez ce programme pour concevoir des oligos shRNA compatibles avec nos vecteurs SORT-A/B/C. L'outil de conception fournit aux cibles les plus grandes chances d'abattre votre gène. Veuillez noter qu'un seul oligo est conçu car il est palindrome.

Centre siDESIGN (Horizon Discovery Ltd., Royaume-Uni) - est un outil de conception de siRNA avancé et convivial, qui améliore considérablement la probabilité d'identifier des siRNA fonctionnels. Des options uniques sont disponibles pour améliorer la spécificité de la cible et adapter les conceptions d'ARNsi pour une conception expérimentale plus sophistiquée.

Conception d'amorces PCR en temps réel :

Conception en temps réel (Technologies de recherche biologique) - gratuit mais sur inscription.

GenScript Real-time PCR (TaqMan) Primer Design - on peut personnaliser la plage de taille potentielle de l'amplicon PCR, Tm (température de fusion) pour les amorces et les sondes, ainsi que l'organisme. Vous pouvez également décider du nombre de jeux d'amorces/sondes que vous souhaitez que l'outil vous renvoie. Il est possible d'utiliser un numéro d'accession GenBank comme modèle.

QuantPrime - est un programme flexible pour la conception d'amorces fiables à utiliser dans des expériences qPCR plus importantes. Le cadre flexible est également ouvert pour une utilisation simple dans d'autres applications de quantification, telles que la conception de sonde d'hydrolyse pour la qPCR et la conception de sonde oligonucléotidique pour la quantification in situ hybridation. (Référence : S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, États-Unis)

Introduction de mutations :

WatCut (Michael Palmer, Université de Waterloo, Canada) - prend un oligonucléotide et introduit des mutations silencieuses dans des sites de restriction potentiels de telle sorte que la séquence d'acides aminés de la protéine ne soit pas altérée.

PrimerX - peut être utilisé pour automatiser la conception d'amorces mutagènes pour la mutagenèse dirigée. Il est disponible en deux saveurs (a) Conception d'amorce basée sur la séquence d'ADN et (b) Conception d'amorce basée sur la séquence de protéines

Primerize-2D - est conçu pour accélérer la synthèse de grandes bibliothèques de mutants souhaités grâce à la conception et à l'organisation efficace des amorces. Le programme sous-jacent et l'interface graphique ont été testés expérimentalement dans notre laboratoire pour des domaines d'ARN avec des longueurs allant jusqu'à 300 nucléotides et des bibliothèques englobant jusqu'à 960 variantes. (Référence : Tian, ​​S., & Das, R. (2017) Bioinformatique 33(9): 1405-1406).

Lorsque vous êtes prêt à configurer votre réaction PCR, consultez :

Calculateur de titrage PCR Box (Allotron Biosensor Corporation) - pour déterminer les quantités de chaque réactif à utiliser dans une boîte de titrage bidimensionnelle pour PCR. Pour les réactions PCR standard, ajustez le volume et remplacez le numéro de "row" et de "column" par "1", cliquez sur tous les boutons "top" ou "bottom" et "done". Calculateur de titrage PCR (Angel Herráez Cybertory : laboratoire virtuel de biologie moléculaire Universidad de Alcalá, Espagne) est un site similaire.

Configuration du mélange de réaction PCR (R. Kalendar, Université d'Helsinki, Finlande) - très beau site (nécessite Java).

Optimisation PCR (Bioline, Royaume-Uni) - beaucoup de conditions

Présentation de l'amorce sur la séquence d'ADN :

Extracteur de séquence (Paul Stothard) - génère une carte de restriction cliquable et une carte d'amorce PCR d'une séquence d'ADN (les formats acceptés sont : raw, GenBank, EMBL et FASTA) offrant un grand contrôle sur la sortie. Les traductions des protéines et les limites intron/exon sont également présentées. Utilisez Sequence Extractor pour construire des constructions d'ADN in silico.


EXPÉRIENCE DE LABORATOIRE : CONCEPTION D'APPRÊTS À BASE DE SYBR® GREEN À L'AIDE DU LOGICIEL PRIMER3

Fond

Chimies fluorescentes de qPCR

Pour quantifier la quantité d'ARNm, d'ADN ou d'ADNc dans un échantillon, l'utilisation de signaux fluorescents non spécifiques ou spécifiques à une séquence peut être utilisée conjointement avec la RT-PCR. Détection spécifique à la séquence (par exemple. TaqMan®, Moeg, Molecular Beacon et Scorpion) utilisent des sondes spécialement conçues qui ont des fluorophores liés à leur extrémité 5' et des extincteurs liés à leur extrémité 3' (Fig. 1). Les fluorophores sont des molécules (ou une partie d'une molécule) qui s'excitent en présence de lumière et libèrent de la fluorescence. Le quencher est une molécule qui éteint la fluorescence. Lorsqu'une réaction qPCR est exécutée à l'aide d'un thermocycleur spécialisé (par exemple. BioRad iCycler), le module optique du thermocycleur sélectionne la bonne longueur d'onde de la lumière et la réfléchit dans le puits où se trouve le mélange de réaction PCR. Les molécules de fluorophore deviennent excitées et fluorescentes, puis le système de détection optique du thermocycleur mesure et quantifie la quantité d'émission fluorescente présente dans chaque tube. Par exemple : une expérience basée sur TaqMan® nécessiterait l'ajout d'une sonde fluorogène ainsi que des amorces spécifiques à la séquence au mélange de réaction PCR. La sonde est une séquence oligonucléotidique, qui est conçue pour s'hybrider à une région interne du produit PCR. Il contient le colorant reporter fluorescent (fluorophore) attaché à son extrémité 5' et une partie quencher attachée à l'extrémité 3' (Fig. 1). Le fluorophore et l'extincteur sont séparés par la longueur de la sonde. La distance est suffisamment proche pour permettre à la fluorescence du quencher de bloquer le signal fluorescent du fluorophore. Cela empêche la détection du signal fluorescent de la sonde. Pendant le cycle d'hybridation, la sonde s'hybridera à sa séquence cible entre les amorces directe et inverse. Tant que la sonde est intacte, la fluorescence du colorant rapporteur est désactivée, cependant, lorsque l'ADN polymérase étend l'amorce et réplique la matrice sur laquelle la sonde TaqMan® est liée, l'activité exonucléase de la polymérase clive la sonde, libérant le rapporteur molécule et permettant de détecter sa fluorescence. Le processus est répété au cours de chaque cycle de la PCR, augmentant le niveau de fluorescence à mesure que des sondes supplémentaires sont clivées. Ces types de détection sont idéaux pour détecter des polymorphismes nucléotidiques uniques ou la détection de séquences spécifiques. Les sondes peuvent être marquées avec différents colorants rapporteurs permettant à l'utilisateur de détecter plus d'une séquence spécifique dans un échantillon (c'est ce qu'on appelle une qPCR multiplex).

Chimies fluorescentes vertes TaqMan® et SYBR®. TaqMan® (1) utilise une sonde qui consiste en une séquence oligonucléotidique avec une molécule reporter fluorescente 5' (F) et un colorant extincteur 3' (Q). Tant que la sonde est attachée, le signal du colorant d'extinction (souvent un colorant coloré à longue longueur d'onde) perturbe le signal du fluorophore (généralement un colorant coloré à courte longueur d'onde). Taq la polymérase étend l'amorce (2) et réplique la matrice sur laquelle la sonde TaqMan® est liée. L'activité exonucléase de Taq la polymérase (3) clive la sonde, libérant le fluorophore 5' (colorant rapporteur) permettant à la fluorescence de se produire. SYBR® Green intercale l'ADNdb. Lorsqu'il est libre dans le mélange réactionnel (1), il n'émet que de faibles quantités de fluorescence. Comme les amorces sont prolongées par Taq, polymérase, et la réplication de la matrice se produit, plus de SYBR® Green est intercalé dans le brin répliqué (2). La fluorescence augmente à mesure que les brins sont répliqués (3).

La détection non spécifique utilise des colorants fluorescents comme le SYBR® Green I. Lorsque le colorant SYBR® Green est ajouté à un mélange de réaction PCR, il se lie immédiatement à tout ADNdb présent et émet un signal fluorescent 1 000 fois supérieur à celui du SYBR® Green non lié [ 5 ] . Au fur et à mesure que le thermocycleur effectue ses cycles (dénaturation → recuit → extension), de nouveaux amplicons sont synthétisés par Taq polymérase et sont immédiatement liés par le colorant SYBR® Green présent dans le mélange. Le résultat est une augmentation de l'intensité de fluorescence qui est directement proportionnelle à l'augmentation de l'ADNdb. Ce type de système de détection est le choix le plus simple et le plus économique pour la qPCR mais a ses inconvénients en ce qu'il n'est pas sélectif. Des faux positifs peuvent résulter de dimères d'amorces et d'une amplification non spécifique. Il est donc essentiel de concevoir des amorces qui réduisent le risque de dimérisation et d'amplification non spécifique.

Principes de base de la conception d'amorces

Le succès d'une PCR conventionnelle à exécuter au maximum dépend d'un bon modèle de départ, un Taq polymérase et solution tampon de bonne qualité et concevant des amorces bien équilibrées entre deux paramètres : spécificité et efficacité. La spécificité est importante car une erreur d'amorçage se produira lorsque les amorces sont mal conçues. Cela conduit à une amplification non spécifique des séquences trouvées dans le pool de matrices. L'efficacité est également importante dans la conception des amorces. Une paire d'amorces efficace produira une multiplication par deux de l'amplicon pour chaque cycle de la PCR. La plupart des logiciels de conception d'amorces sont prédéfinis avec des paramètres par défaut pour la PCR conventionnelle. Cela permet la sélection de paires d'amorces qui produisent un équilibre respectable entre la spécificité de la séquence cible et l'efficacité maximale lorsqu'elles sont utilisées avec un test PCR conventionnel, mais ne sont pas nécessairement les meilleures amorces pour une qPCR.

Dans une application qPCR basée sur SYBR® Green, la spécificité est très importante. Pour comprendre cela, il est important de se rappeler comment fonctionne SYBR® Green. Le colorant SYBR® Green se lie à tout ADNdb présent dans le mélange réactionnel, de sorte que l'amplification de produits non spécifiques produit des données invalides. D'autres facteurs à considérer sont la formation de dimères d'amorces et l'efficacité. Les dimères d'amorces peuvent augmenter la fluorescence, entraînant une quantification inexacte de l'amplicon. L'efficacité (les performances des amorces) d'une réaction qPCR doit atteindre 90 à 100 %. Des amorces efficaces augmentent la sensibilité de la quantification et permettent la reproductibilité du dosage. Les facteurs qui affectent l'efficacité d'une qPCR comprennent la longueur de l'amplicon et la qualité de l'amorce. En bref, la clé pour développer de bonnes amorces à base de SYBR® Green est de trouver une paire d'amorces très spécifiques, ne produisant pas de dimères d'amorces, produisant des amplicons courts et suffisamment efficaces pour produire des résultats cohérents et reproductibles. Connaître les paramètres communs, qui peuvent être ajustés dans la plupart des logiciels de conception d'amorces, peut aider à y parvenir.

Paramètres communs de la conception d'amorces

Longueur d'apprêt

La longueur optimale des amorces est généralement acceptée comme étant de 18 à 24 pb. Des amorces plus longues mettront plus de temps à s'hybrider, plus de temps à s'étendre et plus de temps à retirer, produisant ainsi moins d'amplicon.

Température de fusion de l'amorce (Tm)

C'est la température à laquelle 50% de l'amorce et de son complément sont hybridés. Pour optimiser la qPCR, trouvez des amorces de longueur minimale qui ont des températures de fusion (Tm) qui se situent entre 59 et 68 °C, avec une température optimale Tm de 63 à 64 °C. Également Tm de la paire d'amorces doivent être à moins de 1 °C l'un de l'autre. Les amorces doivent également avoir un Tm qui est plus élevé que le Tm de toute structure secondaire modèle (trouvée à l'aide du logiciel mFOLD, discuté plus loin).

Température de recuit

Les températures optimales de recuit PCR en temps réel sont de 59 °C ou 60 °C.

Taille du produit

Un amplicon idéal devrait se situer entre 80 et 150 pb. Si plusieurs gènes sont utilisés (c'est-à-dire en comparant l'expression relative de plusieurs gènes), la taille de tous les amplicons doit être proche. La détection SYBR® Green produira une fluorescence plus intense dans les produits plus gros que dans les plus petits (donc gardez plusieurs produits proches en longueur).

Mg++ Concentration

La valeur par défaut est définie sur zéro sur la plupart des logiciels de conception d'amorces. Les mélanges tampons SYBR® Green contiennent 3 à 6 mM de MgCl2.

Répétitions

Une répétition est une séquence de nucléotides (un dinucléotide) qui est répétée (par exemple. TCTCTCTCTC). Ceux-ci doivent être évités car ils favorisent les erreurs d'amorçage. Si cela est inévitable, le nombre maximum doit être de 4 di-nucléotides.

Les analyses sont des nucléotides répétés (par exemple. TAAAAAGC a un run de 5 pb d'Adénine). Les courses doivent également être évitées car elles sont sujettes à des erreurs d'amorçage. La course maximale ne doit pas dépasser 3 à 4 pb.

3′ Stabilité

Il s'agit du maximum Δg des 5 bases de l'extrémité 3' des amorces. (Δg est l'énergie libre de Gibbs, l'énergie nécessaire pour rompre les liaisons présentes à l'extrémité 3') Une stabilité 3' plus élevée améliorera l'efficacité de l'amorce.

Pince GC

Il s'agit du maximumg des 5 bases de l'extrémité 5' des amorces. Souvent appelée pince GC, la stabilité 5' fait référence à la stabilité de l'extrémité 5' en raison de la quantité de Gs ou de Cs présente à l'extrémité 5' de l'amorce. Avoir 1 à 2 pinces GC est idéal, car cela permet à l'amorce de se lier fortement au brin modèle, le rendant plus spécifique, mais évitez plus de 2 pinces GC.

Exemple pas à pas de conception d'amorces à l'aide du logiciel Primer3

L'un des logiciels de conception d'amorces les plus couramment utilisés est Primer3 [ 7 ]. Il peut être utilisé pour concevoir des amorces PCR, des amorces de séquençage et des sondes d'hybridation. Primer3 possède de nombreux paramètres d'entrée différents qui peuvent être contrôlés pour définir des caractéristiques permettant au logiciel de concevoir des amorces adaptées à chaque objectif. Cette section donne un exemple étape par étape de la conception d'amorces à l'aide de Primer3 et explique les fonctions des paramètres les plus couramment utilisés. (Remarque : les descriptions suivantes des paramètres de Primer3 sont basées sur le site Web de Primer3 et peuvent être textuelles dans certains cas.)

Étape 1 : Obtenir la séquence au format FASTA

Primer3 accepte les séquences en FASTA, EMBL et autres formats. Pour expliquer l'utilisation de Primer3, une séquence au format FASTA du National Center for Biotechnology Information (NCBI) est utilisée. Le NCBI est une base de données publique financée par le gouvernement contenant des informations génomiques et autres relatives à la biotechnologie. (Noter la Populus trichocarpa (Peulier) déshydroquinate déshydratase/shikimate déshydrogénase (DHQD4) gène utilisé dans cet exemple est le numéro d'accès NCBI XM_002314438.1.)

Dans le menu déroulant (au-dessus du champ de recherche), sélectionnez "Nucléotide".

Dans la zone de recherche, saisissez : XM_002314438.1. Cliquez sur "Rechercher".

Lorsque les résultats apparaissent, cliquez sur « Paramètres d'affichage » situé en haut de la page (sous la barre de recherche, à gauche, en haut de la page), sélectionnez FASTA puis cliquez sur « Appliquer ».

Optionnel: Ouvrez un document Word et copiez la séquence au format FASTA sur une feuille vierge. Cela facilite la vérification du modèle pour les structures secondaires plus tard dans l'expérience.

Étape 2 : Utilisation de Primer3

Cela semble intimidant mais est facile à utiliser une fois que vous vous êtes familiarisé avec les paramètres de recherche. Le logiciel Primer3 peut être utilisé pour concevoir des amorces pour tous les types de PCR, il dispose donc d'une multitude d'options. Après avoir lu ce que font les options, les étudiants apprennent comment modifier les options pour concevoir des amorces pour le gène DHQD4.

Instruction: Rendez-vous sur le site Web de Primer3 à l'adresse : http://frodo. wi.mit.edu/primer3/

Copiez et collez la séquence au format DHQD4 FASTA du document Word dans la case prévue sur la page de conception de l'amorce Primer3 (Fig. 2).

Logiciel en ligne Primer3 pour la sélection des amorces. Saisissez la séquence d'ADN au format FASTA dans la zone de nucléotide. Ci-dessus, la séquence Populus tricocarpa DHQD4 a été saisie. Les identifiants NCBI (indiqués ci-dessus sous la forme >gi|224107416|ref…mRNA) peuvent être saisis avant la séquence mais ne sont pas nécessaires.

Choisissez l'apprêt gauche ou utilisez l'apprêt gauche ci-dessous : Si cette option est laissée vide, le programme Primer3 choisira l'amorce de gauche. Si, toutefois, une séquence d'amorce gauche (ou directe) est déjà connue et que l'utilisateur n'a besoin de créer qu'une amorce droite (ou inverse), la séquence connue sera saisie dans cette case.

Instruction: Pour l'exemple du peuplier, laissez-le vide.

Choisissez la sonde d'hybridation : Une sonde (par exemple. TaqMan®) n'est pas requis dans la détection SYBR® Green, alors laissez ce champ vide. Lors de l'utilisation d'une détection fluorescente basée sur une sonde, une sonde serait conçue avec le jeu d'amorces. Cocher cette option permet à Primer3 de fournir une liste de sondes suggérées qui fonctionneraient avec le jeu d'amorces.

Instruction: Pour l'exemple du peuplier, laissez-le vide.

Choisissez le bon apprêt ou utilisez le bon apprêt ci-dessous : Si cette option est laissée vide, le programme Primer3 choisira la bonne amorce. Si, toutefois, une séquence d'amorce droite (ou inverse) est déjà connue et que l'utilisateur n'a besoin de créer qu'une amorce gauche (ou directe), la séquence connue sera saisie dans cette case.

Instruction: Pour l'exemple du peuplier, laissez-le vide.

Identifiant de la séquence : Un nom pour le jeu d'amorces.

Instruction: Pour l'exemple Poplar, saisissez le nom suivant : Populus trichocarpa DHQD4.

Cibles: Si les amorces doivent être conçues pour un emplacement « spécifique » dans la séquence, l'utilisateur peut utiliser des crochets pour indiquer à Primer3 où concevoir les amorces (par exemple. AA[TAGC]ACC) dirait à Primer3 de concevoir une amorce autour des paires de bases TAGC). Ce choix est utile si vous souhaitez concevoir des amorces pour une zone de séquence spécifique.

Instruction: Pour l'exemple Poplar, ignorez cette option.

Régions exclues : Cette option est très utile si une certaine partie de la séquence doit être évitée. Par exemple, si des amorces oligodT sont utilisées pour effectuer une transcription inverse pour créer de l'ADNc, l'extrémité 5' de l'ARNm (s'il s'agit d'une séquence très longue) ne pourrait pas être représentée dans l'ADNc car l'amorce oligodT peut tomber avant de l'atteindre. Dans ce cas, il faut éviter de concevoir des amorces le long de l'extrémité 5' et cibler plutôt l'extrémité 3' de la séquence. En outre, cette option est très utile si le logiciel Primer3 donne plusieurs amorces du même emplacement (qui ne sont pas satisfaisantes), ou donne des amorces qui créent un amplicon qui a beaucoup de structures secondaires (plus à ce sujet plus tard, lorsque nous discuterons des valeurs mFold ). Pour éviter une zone, entrez les valeurs sous forme de liste séparée par des virgules (par exemple: 81,6 où 81 est la position pb que vous voulez que Primer3 lance cette commande et 6 est le nombre de pb suivant le nucléotide à la position 81 qu'il doit éviter).

Instruction: Pour l'exemple du peuplier, laissez vide.

Gammes de tailles de produits: C'est la taille de votre amplicon. Un amplicon optimal aurait une longueur d'environ 120 pb. En général, des amplicons de 80 à 200 pb sont acceptables, cependant, des amplicons plus longs donnent des résultats qPCR moins efficaces car plus de SYBR® Green est incorporé.

Instruction: Pour l'exemple du peuplier :

Entrez : 80-150 100-200 (cela indique à Primer3 de rechercher d'abord des amorces qui produiront des amplicons entre 80 et 150 pb, puis des amorces qui produiront des amplicons entre 100 et 200 pb.

Numéro à retourner: C'est le nombre de jeux d'amorces que Primer3 retournera. Ce numéro est laissé à la discrétion de l'utilisateur.

Instruction: Pour l'exemple du peuplier, entrez 10.

Maximum 3Stabilité: Il s'agit du maximum Δg des 5 bases de l'extrémité 3' des amorces. (Δg est l'énergie libre de Gibbs g—l'énergie nécessaire pour rompre les liaisons présentes à l'extrémité 3′) Une stabilité 3′ plus élevée améliorera l'efficacité de l'amorce. Plus ce nombre est élevé, plus votre extrémité 3′ est stable. (Remarque : l'utilisateur peut avoir besoin de modifier ce nombre pour obtenir des amorces appropriées.) Souvent, l'équilibre entre l'efficacité et la spécificité est rendu plus difficile en raison de la formation de structure secondaire.

Instruction: Pour l'exemple Poplar, laissez la valeur à 9 (pour renvoyer des amorces plus efficaces).

Erreur d'amorçage de répétition maximale : Répétitions (par exemple. AATATATA) peut provoquer une erreur d'amorçage (le résultat d'un apprêt se liant à un modèle involontaire). Certains eucaryotes (humains, drosophiles et souris par exemple) ont des segments répétés qui sont connus pour être mal amorcés. Parce que cela est courant, des bases de données (appelées bibliothèques) de séquences connues pour provoquer une erreur d'amorçage ont été créées. Cette option permet à Primer3 d'éviter les zones d'amorçage connu lors de la conception des amorces. Si des amorces qPCR sont conçues pour des séquences humaines, de souris ou de mouches des fruits, une bibliothèque doit être choisie en premier. Pour choisir une bibliothèque, vérifiez quelle espèce est utilisée dans la fenêtre déroulante (au-dessus de la zone de saisie de la séquence en haut de la page). Saisissez ensuite la valeur maximale dans la case « Max repeat mispriming ». Cette valeur est la similarité pondérée maximale autorisée de l'amorce individuelle (avant ou arrière) avec tous les nucléotides répétés connus qui provoquent une erreur d'amorçage. Pour réduire le risque d'erreur d'amorçage, laissez le nombre à 12 ou augmentez-le. Comme cette expérience utilise une séquence de peuplier, Primer3 n'aura pas accès à une bibliothèque de désamorçage, laissez donc la valeur à 12. Certains utilisateurs avertis en informatique créent leur propre code pour permettre à Primer3 d'accéder aux bases de données de désamorçage qu'ils ont créées, mais cette technologie est au-dessus de la portée de cette expérience et ne sera pas discuté.

Instruction: Pour l'exemple du peuplier, laissez la valeur à 12.

Paire max répétition erreur d'amorçage : Cette valeur est la similarité pondérée maximale autorisée de la paire d'amorces (à la fois directe et inverse) avec tous les nucléotides répétés connus qui provoquent une erreur d'amorçage. Pour réduire le risque d'amorçage, laissez-le à 24 ou augmentez le nombre.

Instruction: Pour l'exemple du peuplier, laissez la valeur à 24.

Erreur d'amorçage maximum du modèle : Une erreur d'amorçage est le résultat d'une amorce se liant à une matrice involontaire entraînant une amplification. Cette option vérifie les amorces individuelles pour la probabilité qu'elles soient mal amorcées dans une autre zone de la séquence fournie. Les erreurs d'amorçage du modèle doivent être évitées en qPCR, sinon un mélange d'amplicon du produit visé et d'un produit non spécifique sera produit pendant l'amplification. Laissez la valeur à 12 ou augmentez le nombre pour réduire le risque d'amorçage erroné. (Remarque : lorsqu'une qPCR à base de SYBR® Green est exécutée, un contrôle sans modèle (NTC) doit être utilisé et le thermocycleur doit être programmé pour générer une courbe de fusion pour détecter les produits secondaires. Si des pics supplémentaires sont présents dans la courbe de fusion , mais aucun amplicon n'est détecté dans le NTC, les amorces doivent être repensées car ces pics indiquent que des produits non spécifiques sont amplifiés).

Instruction: Pour l'exemple du peuplier, laissez la valeur à 12.

Erreur d'amorçage de modèle de paire max : Cette option vérifie les paires d'amorces pour la probabilité qu'elles soient mal amorcées sur le modèle fourni. Laissez-le à 24 ou augmentez le nombre pour réduire le risque d'amorçage.

Instruction: Pour l'exemple du peuplier, laissez la valeur à 24.

Conditions générales de cueillette des amorces : Ce sont des options générales que l'utilisateur peut définir pour choisir des amorces.

Taille de l'apprêt : La spécificité peut être contrôlée en trouvant un équilibre entre la longueur de l'amorce et la température de recuit de la PCR. La longueur optimale des amorces est généralement acceptée comme étant de 18 à 28 pb. Si vous utilisez des sondes (par exemple. TaqMan®) dans une PCR multiplex, augmenter cette longueur jusqu'à 35 pb. Pour optimiser pour SYBR® Green qPCR, trouvez des amorces de longueur minimale qui ont des températures de fusion (Tm) qui se situent entre 62 et 67 °C, avec une température optimale Tm de 63°C.

Instruction: Pour la valeur minimale, entrez 20 pour Optimum, entrez 25, Pour Maximum, entrez 28

Apprêt Tm: C'est la température à laquelle 50 % de l'amorce et de son complément de matrice sont hybrides. Essayez de concevoir des apprêts avec des températures de fusion comprises entre 62 et 67 °C, avec une Tm de 62 °C à 64 °C. Les Tm la différence entre les amorces directe et inverse ne doit pas dépasser 1 à 2 °C.

Instruction: Minimum, entrez 60, Optimum, entrez 64, Maximum, entrez 70

Maximum Tm Différence, entrez 2

Tableau des paramètres thermodynamiques : Primer3 utilise ces formules pour calculer la température de fusion. La valeur recommandée est SantaLucia1998.

Instruction: Pour l'exemple Poplar, définissez-le sur SantaLucia1998.

Produit Tm: C'est la température à laquelle 50% de l'amplicon est de l'ADNsb. La température varie en fonction du contenu GC du modèle. Idéalement, une zone ciblée sur le modèle aurait un contenu GC de 50 %.

Instruction: Pour l'exemple du peuplier, définissez optimal sur 50.

Amorce GC : C'est le pourcentage minimum et maximum de guanine et de cytosine (GC) autorisé. La teneur en GC des amorces est utilisée pour déterminer la température de fusion de l'amorce, qui peut être utilisée pour prédire la température de recuit. La température de fusion des amorces est généralement de 3 à 5° inférieure à la température de recuit. Idéalement, les amorces qPCR devraient s'hybrider à 59-60 ° C. (Remarque : La plupart des solutions de mélange maître SYBR® Green contiennent des quantités spécifiques de tampon (sel) et de MgCl2, qui modifient la température de fusion de l'apprêt.)

Instruction: Pour l'exemple du peuplier : Minimum 35, Optimum 65, Maximum = 80.

Max Self Complimentary : Les amorces ne doivent pas être auto-complémentaires ou complémentaires les unes aux autres. Les amorces qui sont auto-complémentaires forment des auto-dimères ou des structures en épingle à cheveux. Comme le colorant SYBR® Green interagit avec n'importe quelle structure d'ADN double brin, cette valeur doit être réglée aussi bas que possible. Initialement, définissez la valeur sur 2. Si Primer3 ne fournit pas de jeux d'amorces, augmentez la valeur par incréments de 1 et soumettez à nouveau—répétez si nécessaire.

Instruction: Pour l'exemple du peuplier, définissez la valeur sur 4.

Maximum 3Libre-service : Comme les polymérases ajoutent des bases au 3 fin de l'oligonucléotide, le 3-les extrémités des amorces ne doivent pas être complémentaires, car des dimères d'amorces se produiront. Parfois, cela ne peut pas être évité. Cependant, faites particulièrement attention à la complémentation entre les amorces à 2 ou plusieurs bases à la 3 extrémités des amorces car celles-ci ont tendance à former des amorces plus facilement (voir figure 3). Réglez la valeur faible (par exemple. 2 ou 3) et augmenter par incréments de 1 si Primer3 ne fournit pas de liste d'amorces.

Instruction: Pour l'exemple du peuplier, définissez la valeur sur 3.

#N max : C'est le nombre maximum de bases inconnues que Primer3 pourrait prendre en compte pour fabriquer des amorces. De nombreux gènes, EST (Expressed Sequenced Tags) et ADNc de la GeneBank de NCBI contiennent des bases inconnues (N). Le symbole N est donné comme "espace réservé" lorsque le séquençage ne peut pas déterminer le nucléotide (G,C,T ou A) présent à un certain endroit dans la séquence du gène (ou de l'ADNc). Pour éviter une amplification non spécifique, définissez cette valeur sur zéro.

Instruction: Pour l'exemple du peuplier, définissez sur 0

Max Poly-X : Le nombre maximum de répétitions mononucléotidiques à autoriser dans l'amorce. Longues répétitions mononucléotidiques (par exemple. AAAAAAA) peut favoriser une erreur d'amorçage et doit être évitée. En règle générale, les séries de 3 C ou G ou plus aux 3 les extrémités des amorces doivent être évitées, car leur présence peut favoriser un mauvais amorçage au niveau des séquences C ou riches en C.

Instruction: Pour l'exemple du peuplier, définissez cette valeur sur 3.

Pénalité à l'intérieur de la cible et pénalité à l'extérieur de la cible : Utilisé si l'amorce doit être conçue pour chevaucher une région (par exemple. jonctions lacunaires). « Si l'amorce fait partie d'une paire qui s'étend sur une cible et chevauche la cible, multipliez cette valeur par le nombre de positions de nucléotides par lesquelles l'amorce chevauche la cible (unique) pour obtenir la" pénalité de position "(du site Web Primer3 ). Ce paramètre permet à Primer3 d'inclure le chevauchement de l'amorce avec la zone ciblée de la séquence en tant que terme dans la fonction objectif.

Instruction: La valeur par défaut est ok.

Indice de première base : Ce paramètre indique à Primer3 quel type d'index de programmation est la première base de la séquence d'entrée. GenBank (NCBI) utilise une indexation basée sur un.

Instruction: Par défaut, c'est bien.

Pince GC : Définit les nombres spécifiques de Gs et Cs au 3 extrémité des amorces gauche et droite. Bien que vous vouliez placer des G ou des C sur le 3 extrémités de votre amorce, pas plus de 2-3 G et C doivent être dans les 5 dernières bases aux 3 fin de l'amorce.

Instruction: La valeur par défaut de 0 est très bien.

Conc. de cations monovalents : C'est la concentration millimolaire de sel de KCl (la plupart du temps) dans la PCR. Laisser à 50 M, sauf s'il y a une raison pour laquelle vous avez ajouté plus de sel.

Instruction: La valeur par défaut est ok.

Formule de correction de sel. Des facteurs tels queg et Tm affectent les performances de la PCR et modifient l'efficacité des paires d'amorces. Comme le Tm d'une séquence d'ADN dépend de la longueur, de la séquence, de l'environnement ionique environnant et du pH de l'environnement, il est important d'évaluer la thermodynamique de la dissociation et de l'association des brins nucléotidiques pendant la PCR. Primer3 utilise des formules basées sur le modèle du voisin le plus proche avec correction du sel. La formule de sel SantaLucia 1998 est préférée par Primer3. Cette formule est conçue pour s'adapter à la correction du sel indépendamment de la séquence mais en fonction de la longueur de l'oligonucléotide.

Instruction: Pour l'échantillon Poplar, sélectionnez SantaLucia 1998.

Conc. des cations divalents : Il s'agit de la concentration de sels divalents (généralement MgCl 2+ ) présents dans le mélange PCR. Les mélanges SYBR® Green contiennent généralement ∼3 mM.

Instruction: Passer à 3,5 mM (pour ajuster le MgCl dans le SYBR Green Supermix)

Conc. des dNTP : Une concentration de dNTP de 200 M est généralement recommandée pour que la Taq polymérase fonctionne efficacement dans une PCR conventionnelle, où MgCl2 les concentrations sont de 1,5 mM. L'augmentation des concentrations de dNTP peut inhiber les réactions PCR en piégeant le Mg libre. Certains master mix SYBR® Green sont préparés avec taq, KCL, MgCl2, et dNTP déjà dans le mix. Ces mélanges ont été testés en laboratoire pour offrir des performances maximales.

Instruction: Pour l'exemple du peuplier, utilisez 0,20 mM

Concentration d'oligo de recuit : Utilisé pour calculer la température de fusion des oligo, il s'agit de la concentration nanomolaire des oligos de recuit dans la PCR. Comme la valeur dépend de la quantité d'oligos et de la quantité de matrice, il est difficile de calculer cette valeur (étant donné que l'ADNc est utilisé comme matrice). Primer3 affirme que la valeur par défaut (50 nM) fonctionne bien pour la plupart des applications.

Instruction: Pour l'exemple Poplar, la valeur par défaut est ok.

Poids des pénalités des fonctions objectives pour les amorces: La section des poids de pénalité permet aux utilisateurs de Primer3 de modifier les critères que Primer3 utilise pour sélectionner les meilleurs ensembles d'amorces. Si aucun poids de pénalité n'est attribué, le programme utilisera les informations fournies par l'utilisateur pour les spécifications « General Primer Picking » et classera chaque jeu d'amorces en fonction de ces conditions. En utilisant des poids de pénalité, l'utilisateur dit à Primer3, "ce critère est plus important qu'un autre". Les utilisateurs entrent les poids de pénalité dans les valeurs 0, 1, 2, 3, etc. 0 étant moins important. Par exemple, on pourrait décider que les dimères d'amorces sont plus préoccupants que les amplicons secondaires. Ensuite, l'option Self Complementary peut être définie sur 3 et Template Mispriming sur 2. Certains paramètres ont deux cases (Lt et Gt). Cette option inférieur à (Lt)/supérieur à (Gt) permet une plus grande flexibilité dans le choix des amorces. Par exemple, si l'utilisateur a spécifié sous « Conditions générales de sélection des amorces » que la taille de l'amorce (Taille) doit être comprise entre 18 pb et 27 pb, toutes les amorces prises en compte seront pénalisées si elles sont inférieures à 18 pb ou supérieures à 27 pb. Un utilisateur pourrait donner une pénalité de 2 pour les amorces plus courtes que 18 pb et une pénalité de 0 pour les amorces supérieures à 27 (si des amorces plus longues seraient acceptables).

Instruction: Pour l'exemple du peuplier, modifiez les poids de pénalité suivants :


Lors de la conception des amorces, quelle est l'importance de la pince GC ? - La biologie

Concevoir des amorces pour la PCR

Le Primer Designer dispose d'une interface en temps réel puissante mais extrêmement simple pour permettre l'identification rapide des amorces théoriques idéales pour vos réactions PCR. Les paires d'amorces sont calculées à partir des régions cibles définies, puis criblées par rapport à une série de paramètres pour maximiser l'efficacité d'amorçage pour une PCR sans problème.

Le principal Concepteur d'amorces Le formulaire se compose essentiellement de deux grilles et de quelques contrôles de paramètres. Les grilles montrent toutes les amorces directes (côté gauche) et inverses (côté droit) possibles qui se conforment aux paramètres définis et se situent dans les régions cibles spécifiées pour chaque amorce. Vous remarquerez immédiatement qu'en rendant les conditions de sélection des amorces plus strictes, la liste des amorces possibles diminuera. Ce processus de criblage en temps réel permet d'affiner très rapidement la liste des amorces potentielles, et de sélectionner celles qui correspondent le mieux aux besoins de votre expérience.

Les régions à partir desquelles les amorces sont choisies peuvent être visualisées et ajustées sur le Carte de séquence interactive. Les régions sont représentées par des cadres délimités, colorés en vert pour les amorces directes et en violet pour les amorces inverses. Les régions peuvent être déplacées en les faisant glisser avec la souris, et leur taille ajustée en cliquant sur leurs bords et en les étirant à la taille souhaitée.Pour un réglage fin de la position ou de la taille de la région, sélectionnez simplement la case entière ou le bord approprié, puis utilisez les flèches gauche et droite pour déplacer votre sélection à la position exacte souhaitée. Les régions de sélection des amorces sont également présentées dans le Éditeur de séquence sous forme de régions ombrées de vert clair et de violet.

Les positions des amorces directes et inverses actuellement sélectionnées dans les tableaux du formulaire Primer Designer sont affichées sur la carte de séquence interactive sous forme de barres vertes et violettes continues et sur l'éditeur de séquences sous forme de régions vertes et violettes sombres.

Réglage des paramètres de sélection d'amorce

Divers paramètres peuvent être ajustés sur le formulaire Primer Designer, vous permettant de spécifier comment les amorces seront tamisées. Bien que les réglages par défaut des paramètres soient adéquats pour une réaction PCR typique, vous devrez probablement les ajuster dans une certaine mesure en fonction de la nature de votre expérience. Les paramètres et leurs fonctions sont décrits dans le tableau ci-dessous :

ParamètreFonction
Plage de longueurSpécifie les longueurs minimale et maximale des amorces.
Plage de %GCSpécifie le pourcentage minimum et maximum de contenu GC dans l'amorce. Les amorces efficaces ont généralement des %GC d'environ 50.
Gamme TmSpécifie la température de fusion minimale et maximale (en degrés Celsius) de l'apprêt, telle que calculée par la méthode du voisin le plus proche (voir ci-dessous).
Stabilité d'extrémité de 3'Détermine le D G des 5 dernières bases à l'extrémité 3'. Une extrémité 3' instable (moins de D G négatif) entraînera moins de faux amorçages.
5' de stabilité d'extrémité (collier GC)Détermine le D G des 5 dernières bases à l'extrémité 5'. Une extrémité 5' stable (plus de D G négatif) se traduira par une liaison plus efficace et plus spécifique à la matrice.
Dimère D GSpécifie le D G minimum tolérable pour la formation de dimères d'amorces.
D G Épingle à cheveuxSpécifie le D G minimum tolérable pour la formation en épingle à cheveux de l'amorce.

Dans les fonctions ci-dessus, toutes les valeurs D G sont calculées selon la méthode du plus proche voisin (Breslaur et al., 1986).

Il existe trois méthodes couramment utilisées pour calculer le Tm. Expression utilise la méthode la plus précise, voisin le plus proche. Les formules et références des différentes méthodes sont résumées dans le tableau ci-dessous :


Conception d'amorce PCR

Conception d'amorces pour PCR
Considérations générales sur la conception. Sois sûr que:

  • La longueur de l'amorce est comprise entre 15 et 30 pb homologue à la séquence d'ADN cible. Je suggère de commencer avec des amorces de 20-25 pb.
  • La Tm de chaque amorce est comprise entre 55 et 65 °C
  • La teneur en GC de chaque amorce est comprise entre 40 et 60 %
  • Les Tm des deux amorces sont très similaires, c'est-à-dire à l'intérieur

Considérations spécifiques pour les pièces Golden Gate

Considérations spécifiques pour les pièces BioBrick

    • Assurez-vous que l'ADN génomique à amplifier ne contient aucun site EcoRI, PstI, SpeI ou XbaI.
    • Je crée généralement un produit PCR qui a un site XbaI en amont de la pièce et des sites SpeI, NotI et PstI en aval de la pièce.
    • La partie Biobrick commence par un codon d'initiation (ATG) et se termine par deux codons d'arrêt consécutifs (TAATAA).
    • Ensuite, l'amorce directe doit être de la forme :

    5′ CCTTTCTAGAG (15-20 pb du brin codant, ATG de départ) 3′

    et l'amorce inverse doit être de la forme :

    5′ AAGG’CTGCAGCGGCGCGCCTACTAGT’A (complément inverse de 15-20 pb, départ TTATTA) 3′

    Ici, il y a quatre nucléotides (en italique) flanquant les sites de restriction (en gras) de tels espaceurs sont nécessaires pour permettre aux enzymes de restriction de couper correctement.

    Considérations spécifiques pour les pièces BioFusion

    • Assurez-vous que l'ADN génomique à amplifier ne contient aucun site EcoRI, PstI, SpeI ou XbaI.
    • Je crée généralement un produit PCR qui a un site XbaI en amont de la pièce et des sites SpeI, NotI et PstI en aval de la pièce.
    • L'insert de l'amorce sens ne commence pas par TC (ou bien un site DAM I (GATC) se forme, et Xbal ne peut pas couper).
    • La construction Biofusion ne commence pas par un codon de départ, ni ne se termine par un codon d'arrêt.
    • Ensuite, l'amorce directe doit être de la forme :

    5′ ”CCTT””’TCTAGA”’ (15-20 pb du brin de codage) 3′
    et l'amorce inverse doit être de la forme :
    5′ ”AAGG””’CTGCAGCGGCGCGCACTAGT”’ (complément inverse de 15-20 pb) 3′
    Ici, il y a quatre nucléotides (en italique) flanquant les sites de restriction (en gras) de tels espaceurs sont nécessaires pour permettre aux enzymes de restriction de couper correctement.

    • Remarque : s'il n'est pas possible de créer un bon ensemble d'amorces avec les régions flanquantes décrites ci-dessus, essayez de changer les 4 premières bases – qui sont externes au site de restriction – de chaque amorce, par ex. <br>5′ ”AAGG””’TCTAGA”’ (15-20 pb du brin de codage) 3′ <br>
    • Remarque : si vous n'êtes toujours pas en mesure d'obtenir un bon ensemble d'amorces, essayez d'utiliser un ensemble complètement différent de régions flanquantes pour améliorer les amorces. Par exemple, vous pouvez également utiliser un produit PCR qui a les sites EcoRI, NotI et XbaI en amont de votre pièce, tandis que le site SpeI est en aval de votre pièce.

    Dans ce cas, l'amorce directe serait de la forme : 5′ ”CCTT””’GAATTCGCGGCCGCATCTAGA”’ (complément de 15-20 pb au brin codant)3′ et l'amorce inverse devrait être de la forme forme : <br> 5′ ”AAGG””’’ACTAGT”’ (complément de 15-20 pb au brin de codage) 3′.

    Conception d'amorces à l'aide de Vector NTI
    Un moyen simple de concevoir des amorces consiste à utiliser Vector NTI.


    Lors de la conception des amorces, quelle est l'importance de la pince GC ? - La biologie

    Pour les grandes matrices telles que les BAC, les PAC et les cosmides qui peuvent avoir des niveaux d'impuretés plus élevés, nous recommandons l'utilisation de l'amorce SP6long au lieu de l'amorce SP6 standard, qui a une Tm légèrement basse. L'amorce SP6long est plus longue de quatre bases (vérifiez donc la compatibilité avec vos vecteurs) mais fonctionne bien pour les grands modèles lorsque l'amorce SP6 plus courte échoue.

    Considérations relatives à la conception de l'apprêt

    • Une température de fusion (Tm) comprise entre 50 C et 65 C
    • Absence de capacité de dimérisation
    • Absence de formation en épingle à cheveux significative (> 3 pb)
    • Manque de sites d'amorçage secondaires
    • Liaison spécifique faible à modérée à l'extrémité 3' (éviter une teneur élevée en GC pour éviter les erreurs d'amorçage)

    Enfin, sachez qu'aucun ensemble de directives ne prédit toujours avec précision le succès d'une amorce. Certaines amorces peuvent échouer sans raison apparente, et les amorces qui semblent être de mauvais candidats peuvent bien fonctionner.


    BatchPrimer3 est un autre logiciel de conception d'amorces basé sur Primer3 disponible gratuitement en ligne. Il existe une énorme quantité de sous-types d'amorces à concevoir, y compris des amorces PCR génériques. BatchPrimer3 nécessite la saisie ou le téléchargement d'une séquence FASTA. Une sélection intermédiaire de paramètres d'amorce est également là pour peaufiner.

    Les Primer Design Tools d'Eurofins Genomics utilisent le programme Prime+ du package GCG Wisconsin, écrit à l'origine par Irv Edelman. Tout ce qui est requis est une séquence cible, qui est copiée et collée dans le programme, puis vous avez la possibilité de modifier les paramètres de conception. La sortie comprend également une température de recuit suggérée à utiliser pour chaque paire d'amorces.

    Avez-vous des suggestions de logiciels de conception d'amorces PCR gratuites à ajouter à la liste ? Laissez un commentaire ci-dessous avec votre choix préféré et je ne manquerai pas de mettre à jour la liste.


    Voir la vidéo: Cynistic Plays Everlasting Summer - Part 60 - Youre Hot Then Youre Cold, Youre Yes Then Youre (Janvier 2023).